ID: 903323085

View in Genome Browser
Species Human (GRCh38)
Location 1:22554112-22554134
Sequence CTCCATGGTGAGATGGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903323078_903323085 11 Left 903323078 1:22554078-22554100 CCCACAGCCTGGCTCCTTCTCCA No data
Right 903323085 1:22554112-22554134 CTCCATGGTGAGATGGCCCAAGG No data
903323079_903323085 10 Left 903323079 1:22554079-22554101 CCACAGCCTGGCTCCTTCTCCAT No data
Right 903323085 1:22554112-22554134 CTCCATGGTGAGATGGCCCAAGG No data
903323081_903323085 -3 Left 903323081 1:22554092-22554114 CCTTCTCCATGATCTGCTTGCTC No data
Right 903323085 1:22554112-22554134 CTCCATGGTGAGATGGCCCAAGG No data
903323080_903323085 4 Left 903323080 1:22554085-22554107 CCTGGCTCCTTCTCCATGATCTG No data
Right 903323085 1:22554112-22554134 CTCCATGGTGAGATGGCCCAAGG No data
903323083_903323085 -9 Left 903323083 1:22554098-22554120 CCATGATCTGCTTGCTCCATGGT No data
Right 903323085 1:22554112-22554134 CTCCATGGTGAGATGGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903323085 Original CRISPR CTCCATGGTGAGATGGCCCA AGG Intergenic
No off target data available for this crispr