ID: 903323089

View in Genome Browser
Species Human (GRCh38)
Location 1:22554130-22554152
Sequence CAAGGTAGCAGCCAGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903323081_903323089 15 Left 903323081 1:22554092-22554114 CCTTCTCCATGATCTGCTTGCTC No data
Right 903323089 1:22554130-22554152 CAAGGTAGCAGCCAGAGCCCTGG No data
903323080_903323089 22 Left 903323080 1:22554085-22554107 CCTGGCTCCTTCTCCATGATCTG No data
Right 903323089 1:22554130-22554152 CAAGGTAGCAGCCAGAGCCCTGG No data
903323083_903323089 9 Left 903323083 1:22554098-22554120 CCATGATCTGCTTGCTCCATGGT No data
Right 903323089 1:22554130-22554152 CAAGGTAGCAGCCAGAGCCCTGG No data
903323078_903323089 29 Left 903323078 1:22554078-22554100 CCCACAGCCTGGCTCCTTCTCCA No data
Right 903323089 1:22554130-22554152 CAAGGTAGCAGCCAGAGCCCTGG No data
903323086_903323089 -7 Left 903323086 1:22554114-22554136 CCATGGTGAGATGGCCCAAGGTA No data
Right 903323089 1:22554130-22554152 CAAGGTAGCAGCCAGAGCCCTGG No data
903323079_903323089 28 Left 903323079 1:22554079-22554101 CCACAGCCTGGCTCCTTCTCCAT No data
Right 903323089 1:22554130-22554152 CAAGGTAGCAGCCAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903323089 Original CRISPR CAAGGTAGCAGCCAGAGCCC TGG Intergenic
No off target data available for this crispr