ID: 903325687

View in Genome Browser
Species Human (GRCh38)
Location 1:22567392-22567414
Sequence ACATTGCCTGAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 1, 2: 4, 3: 38, 4: 350}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903325672_903325687 29 Left 903325672 1:22567340-22567362 CCCCTCCCACCAGCCAGCAGGAG 0: 1
1: 1
2: 7
3: 60
4: 585
Right 903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG 0: 1
1: 1
2: 4
3: 38
4: 350
903325678_903325687 20 Left 903325678 1:22567349-22567371 CCAGCCAGCAGGAGGAGAGAGCT 0: 1
1: 1
2: 4
3: 42
4: 379
Right 903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG 0: 1
1: 1
2: 4
3: 38
4: 350
903325673_903325687 28 Left 903325673 1:22567341-22567363 CCCTCCCACCAGCCAGCAGGAGG 0: 1
1: 0
2: 6
3: 65
4: 422
Right 903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG 0: 1
1: 1
2: 4
3: 38
4: 350
903325671_903325687 30 Left 903325671 1:22567339-22567361 CCCCCTCCCACCAGCCAGCAGGA 0: 1
1: 2
2: 8
3: 80
4: 780
Right 903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG 0: 1
1: 1
2: 4
3: 38
4: 350
903325679_903325687 16 Left 903325679 1:22567353-22567375 CCAGCAGGAGGAGAGAGCTTGCC 0: 1
1: 1
2: 0
3: 28
4: 264
Right 903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG 0: 1
1: 1
2: 4
3: 38
4: 350
903325680_903325687 -5 Left 903325680 1:22567374-22567396 CCTGACCCAGTTTTCTCTACATT 0: 1
1: 0
2: 0
3: 30
4: 260
Right 903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG 0: 1
1: 1
2: 4
3: 38
4: 350
903325681_903325687 -10 Left 903325681 1:22567379-22567401 CCCAGTTTTCTCTACATTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 193
Right 903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG 0: 1
1: 1
2: 4
3: 38
4: 350
903325677_903325687 23 Left 903325677 1:22567346-22567368 CCACCAGCCAGCAGGAGGAGAGA 0: 1
1: 0
2: 7
3: 51
4: 406
Right 903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG 0: 1
1: 1
2: 4
3: 38
4: 350
903325676_903325687 24 Left 903325676 1:22567345-22567367 CCCACCAGCCAGCAGGAGGAGAG 0: 1
1: 0
2: 3
3: 41
4: 377
Right 903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG 0: 1
1: 1
2: 4
3: 38
4: 350
903325675_903325687 27 Left 903325675 1:22567342-22567364 CCTCCCACCAGCCAGCAGGAGGA 0: 1
1: 0
2: 6
3: 57
4: 389
Right 903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG 0: 1
1: 1
2: 4
3: 38
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903325687 Original CRISPR ACATTGCCTGAGAGGGAGGG AGG Intronic
900257412 1:1704338-1704360 ACCTCCCCTGGGAGGGAGGGAGG + Exonic
900265022 1:1753128-1753150 CCATTCCCAGGGAGGGAGGGAGG - Intronic
900589480 1:3453414-3453436 CCATCCCCTGGGAGGGAGGGTGG - Intergenic
900611786 1:3547321-3547343 ACCTTCCCTGGGAGCGAGGGAGG - Intronic
900766578 1:4509901-4509923 ACAGGCCCTGAGAAGGAGGGTGG + Intergenic
901401454 1:9017757-9017779 CCATTGCCTGAGAGCGAGTGGGG - Intronic
901647683 1:10725347-10725369 AGCCTGCCGGAGAGGGAGGGCGG - Intronic
901861820 1:12079422-12079444 CCCTTGCCTGGGAGGGAAGGAGG - Intronic
903000500 1:20262188-20262210 AGATTGCCCCAGCGGGAGGGTGG - Intergenic
903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG + Intronic
903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG + Intronic
903557989 1:24206917-24206939 GCATCCCCTGGGAGGGAGGGAGG + Intergenic
903699379 1:25235241-25235263 ACATTCCCTGTGAGGAAGGTAGG - Intergenic
904787255 1:32992225-32992247 AGATTGCCTGGGAGAGAGGTAGG - Intergenic
905789115 1:40781093-40781115 GTATTGACTGAGAGGAAGGGTGG - Intergenic
906533579 1:46538723-46538745 CCAGTGCCTGAGCAGGAGGGAGG + Intergenic
907196017 1:52687691-52687713 TTGTTGCCTGGGAGGGAGGGTGG + Exonic
907383730 1:54111833-54111855 GCCTTGCCAGAGAGGGAGGCCGG - Intronic
909342218 1:74544962-74544984 ACATTTGTTGAGAGGGTGGGGGG + Intergenic
910112671 1:83699494-83699516 ACATTGCCTGGGAGTGGAGGGGG - Intergenic
916438725 1:164801054-164801076 ACATTGACTAAAAGGGAGTGAGG - Intronic
918092706 1:181311152-181311174 ACCTTCCCTGAAAGGTAGGGAGG + Intergenic
918103765 1:181398932-181398954 GCATTGCCTGGAAGGGAGGAAGG - Intergenic
918312125 1:183292410-183292432 ACATTCCCTGAAAGGTAGTGAGG + Intronic
919972493 1:202590282-202590304 ACATTGTCTGGGAGGCTGGGCGG - Exonic
920672559 1:208015650-208015672 CCCCTGCCTGACAGGGAGGGTGG + Intergenic
921063627 1:211607440-211607462 CCATTCCCAGAAAGGGAGGGAGG + Intergenic
921417750 1:214910389-214910411 ACATAGAGTGAGAGGAAGGGAGG + Intergenic
921947488 1:220896069-220896091 ACATTGTTTTAGAGGGCGGGTGG + Intergenic
922183678 1:223256041-223256063 GCCTTGCCTGGGAAGGAGGGAGG + Intronic
923235716 1:232031099-232031121 ACACTGCCAAAGAAGGAGGGAGG + Intronic
923622159 1:235588049-235588071 ACAGCGCCTGGGAGGGAGAGAGG - Intronic
923698182 1:236275501-236275523 ACATTGACTTATTGGGAGGGTGG - Intronic
1063086058 10:2818526-2818548 ACCAAGACTGAGAGGGAGGGAGG + Intergenic
1063470116 10:6277630-6277652 ACATGGCCAGAGCAGGAGGGAGG - Intergenic
1064403559 10:15040916-15040938 ACAGTGCTTAAGAGGGAGGCAGG - Intronic
1064945116 10:20778521-20778543 ACTTTGCCTAACAGGGATGGTGG - Intergenic
1065156266 10:22873169-22873191 AAATTCCTTGTGAGGGAGGGAGG + Intergenic
1065209736 10:23391040-23391062 ACATTCCCTGTGGGGGTGGGAGG + Intergenic
1066292314 10:34025706-34025728 ACACTGCCTGAGAGTAAGGCAGG + Intergenic
1067199790 10:44157110-44157132 ATACTGCCTGAGAAGGTGGGAGG - Intergenic
1067658842 10:48218477-48218499 GCATAGACTGAGAGGGAGGAAGG - Intronic
1067925141 10:50501089-50501111 ACATGGGATGAGAGGGAAGGAGG - Intronic
1068889309 10:62132312-62132334 ACATGGCCAGAGAAGGAGGAAGG - Intergenic
1069855464 10:71438542-71438564 ACATGGGCTGAGAGGGATTGAGG + Intronic
1071235325 10:83639789-83639811 ATATTTCCTGAGAGAGAGAGAGG + Intergenic
1072546938 10:96447232-96447254 ACAGGGCCAGAGAGGGAGGCAGG + Intronic
1072921959 10:99584051-99584073 AAATTGGGAGAGAGGGAGGGAGG - Intergenic
1072969983 10:100009506-100009528 TCATTGCCGGAGTGGCAGGGCGG + Intronic
1074288413 10:112120061-112120083 ACATGGCCTGAGAGTAAGGGCGG - Intergenic
1074861154 10:117511619-117511641 TCATTTCCTGAGAGGCAGGATGG - Intergenic
1075138394 10:119808230-119808252 ACATTACATCAGAGGGAGAGGGG + Intronic
1076017493 10:127039903-127039925 ACATGGTCTTAGAGAGAGGGTGG + Intronic
1076507128 10:130985600-130985622 TCATGGGCTGGGAGGGAGGGTGG - Intergenic
1078081347 11:8206850-8206872 ACATTTGTTCAGAGGGAGGGTGG - Intergenic
1080787136 11:35485765-35485787 ACAGAGCCTTAGAAGGAGGGAGG - Intronic
1080828668 11:35870928-35870950 CCATTGCCTGAGAGGGAGGAGGG - Intergenic
1081744676 11:45464524-45464546 ACATTGACTGCCAGGGAGAGGGG - Intergenic
1082004489 11:47412150-47412172 AGCTTGCCTGGGAGGGAGGGAGG + Intronic
1083736005 11:64681860-64681882 ACCATGCCAGAGAGGGAGAGAGG + Intronic
1085734972 11:79031114-79031136 ACAGTGCCTGACATGGAGGAGGG + Intronic
1087409123 11:97768183-97768205 ACATGGCATGAGAGGGAGGAGGG + Intergenic
1087921230 11:103868954-103868976 ACTTAGCCTGAAAGGGAAGGTGG - Intergenic
1090196002 11:124817269-124817291 GCCTTGCCTGAAAGGGAGGAAGG + Intergenic
1090804542 11:130194624-130194646 CCACAGCCTGAGAGGGAAGGTGG - Exonic
1091041255 11:132283992-132284014 GCATTGCCTCAGAGGGAGGAAGG - Intronic
1091240138 11:134046596-134046618 ACATTTCCTGACAGTGAGGAGGG - Intergenic
1091700260 12:2654326-2654348 CTAATGGCTGAGAGGGAGGGAGG + Intronic
1092704929 12:11271905-11271927 ACACTGTCTGTGAGTGAGGGTGG + Intergenic
1093174570 12:15898301-15898323 TTATTGGCTGGGAGGGAGGGGGG + Intronic
1093185136 12:16011555-16011577 ACTTTTGCTGAGAGGGAAGGGGG - Intronic
1094008763 12:25784328-25784350 GCCTAGCCTGAGAGAGAGGGTGG - Intergenic
1094214194 12:27923110-27923132 ACCTTCCCAGAGAGGGAGGCTGG - Intergenic
1096497104 12:52044963-52044985 TTCTGGCCTGAGAGGGAGGGAGG + Intronic
1097247806 12:57616179-57616201 ACATTGGCTGACAGGGAGGGAGG + Intronic
1100211433 12:92402449-92402471 TGGGTGCCTGAGAGGGAGGGAGG + Intergenic
1103806053 12:123574041-123574063 ACATGGCTTGAGTGGGAGAGAGG - Intergenic
1103883915 12:124186959-124186981 ACAGAGACAGAGAGGGAGGGAGG + Intronic
1104099187 12:125590070-125590092 ACATGGTCAGAGAGGGAGTGAGG - Intronic
1104192703 12:126498643-126498665 ACATAGACTGAGAGTGAGGAAGG - Intergenic
1104415586 12:128594562-128594584 GCCTTGCTTGGGAGGGAGGGTGG - Intronic
1104462784 12:128969131-128969153 ACAGAGACTGAGAGGGAGGAAGG - Intronic
1104476646 12:129075926-129075948 AGGTTCTCTGAGAGGGAGGGAGG - Intronic
1105432788 13:20352294-20352316 ACAGTGCAGGAGAGGGAGGGGGG - Intergenic
1106407250 13:29484669-29484691 ACATGGGATGAGAGAGAGGGAGG - Intronic
1107569228 13:41638913-41638935 CCAGTGCCTGAGCAGGAGGGAGG + Intronic
1108380130 13:49847214-49847236 GCCTTGCATGAGAGGGAGGGAGG + Intergenic
1110188416 13:72701827-72701849 ACAATGAGCGAGAGGGAGGGAGG - Intergenic
1112235180 13:97629563-97629585 GCATTGGCTGAGAAGCAGGGGGG - Intergenic
1112494539 13:99894723-99894745 ACCTTGCCTGAGGCGGGGGGGGG + Exonic
1113704633 13:112419753-112419775 AGATTGCCTGAGAGTGAGGCTGG + Intronic
1113735433 13:112675169-112675191 ACATTGCGTGATAGGGAATGGGG - Intronic
1115014039 14:28587916-28587938 ACAATCCATGAGTGGGAGGGTGG + Intergenic
1119438379 14:74612309-74612331 TCATTACCGGAGAGGGAGCGAGG + Exonic
1119965821 14:78914503-78914525 AGATTGCCTGAGTGAGAAGGTGG + Intronic
1120222193 14:81747059-81747081 ATAGGGCCTGAGAGGGATGGGGG + Intergenic
1120510644 14:85409763-85409785 CCATTGTCTGAGAGGAAGAGGGG - Intergenic
1121455933 14:94038860-94038882 ACATTTCCTGGGAGAGATGGGGG + Intronic
1122010181 14:98740214-98740236 AGGCTGCCTGAGAGAGAGGGAGG - Intergenic
1122460221 14:101888469-101888491 CCAAAGCCTAAGAGGGAGGGAGG - Intronic
1122795992 14:104206487-104206509 CCGCAGCCTGAGAGGGAGGGAGG + Intergenic
1124874771 15:33581492-33581514 ACATTCCCTGAGAAGGAGAGTGG - Exonic
1125203265 15:37121563-37121585 ACTTTTCCTGAGAGGCATGGTGG + Intergenic
1125344020 15:38700709-38700731 ACAGAGACAGAGAGGGAGGGAGG + Intergenic
1125996270 15:44164142-44164164 ACATTGTCTGGAAGGGAGTGGGG - Intronic
1126537039 15:49777765-49777787 ACATGGCGTGAGAGGAAGAGAGG + Intergenic
1127535969 15:59890225-59890247 AGAATGCCTGAGAGGGTGGAAGG + Intergenic
1127860232 15:62988034-62988056 ATACTGCCTTAGAGGGAGGAAGG - Intergenic
1128249636 15:66155321-66155343 AATTTGCCTCAGAGTGAGGGCGG + Intronic
1128549943 15:68591567-68591589 ACATTGCCCTAGAGGCAGAGAGG + Intronic
1128722095 15:69957580-69957602 AGATTACCTGAGAGGAAGGGAGG - Intergenic
1128793767 15:70450463-70450485 ACTATGCCTGAGGGGGAGGTGGG - Intergenic
1129122430 15:73408788-73408810 GCAGTGCATGAGAGGTAGGGAGG + Intergenic
1129869954 15:78933748-78933770 GGAGAGCCTGAGAGGGAGGGTGG - Intronic
1134008152 16:10832168-10832190 AGATGGGCTGAGAGGCAGGGAGG + Intergenic
1134016049 16:10889196-10889218 ACATTGCCAGAGCGGGATGGAGG - Intronic
1135125817 16:19808476-19808498 ACATGGCAAGAGAGGCAGGGTGG - Intronic
1135937274 16:26792022-26792044 ACATGGACTGAGAGTGAGGGAGG - Intergenic
1136993528 16:35172289-35172311 ACAAGGCCTGTCAGGGAGGGTGG + Intergenic
1136994941 16:35182873-35182895 ACAATGCAGGAGAGGGTGGGGGG + Intergenic
1137434134 16:48441729-48441751 ACCTTGCCTCAAAGGGAGGCTGG - Intronic
1138148972 16:54637688-54637710 ACTTTGCCTGAGGGAGAGGTTGG + Intergenic
1139254875 16:65531207-65531229 AGATTGGATGAGAGGTAGGGTGG - Intergenic
1139534639 16:67563480-67563502 ACGCTGCCTGAGCGGGCGGGGGG + Intronic
1140014200 16:71165727-71165749 ACATGGCGTGAGGGGGAGGGGGG + Intronic
1140230181 16:73111571-73111593 ATATTCTCTGTGAGGGAGGGAGG + Intergenic
1141422446 16:83925766-83925788 GCATTGCCTGGGAGGCAGGGAGG - Exonic
1141558481 16:84851662-84851684 TCATTGCCTGGGAGGGACGCAGG + Intronic
1142274569 16:89110819-89110841 ACACTGCCATCGAGGGAGGGAGG - Intronic
1142280904 16:89147111-89147133 ACATGGCCGGAGCAGGAGGGAGG + Intronic
1142471155 17:164070-164092 GCATTGCCTGAGGTGGTGGGCGG + Intronic
1142580041 17:936337-936359 GCAGTGCCTCAGAGGGAGGGCGG - Intronic
1143140317 17:4738914-4738936 CCATTGCCTGCGCGGGACGGAGG + Exonic
1144132900 17:12265451-12265473 CCAGTGCCTCAGAGGGAGTGTGG - Intergenic
1144547866 17:16215032-16215054 ACAGGGCCTGCGAGGGAGAGCGG - Intronic
1144603712 17:16644058-16644080 ACATAGCAAGAGAGGGAGAGGGG - Intronic
1144969071 17:19095741-19095763 CCATTGTCTGAGAGAGTGGGTGG + Intronic
1144978845 17:19156325-19156347 CCATTGTCTGAGAGAGTGGGTGG - Intronic
1144989377 17:19221907-19221929 CCATTGTCTGAGAGAGTGGGTGG + Intronic
1146790659 17:35748801-35748823 ACAGTGGAGGAGAGGGAGGGTGG + Intronic
1147510362 17:41063697-41063719 ACAATGCCTTATGGGGAGGGAGG + Intergenic
1148684368 17:49492836-49492858 GCAATGGCAGAGAGGGAGGGAGG + Intergenic
1148726153 17:49791726-49791748 AAGTTGCCTGAGGGGGTGGGAGG + Intronic
1151375310 17:73684468-73684490 AGTTTGCCTGGGAGGGAGGCAGG + Intergenic
1151574655 17:74946645-74946667 TCATTGCCTGGGAGGGAGGCAGG - Exonic
1152425890 17:80218498-80218520 ACATTGCCTCTGAGGGAGCTGGG - Intronic
1152646910 17:81473448-81473470 AGATTGGCTGGGGGGGAGGGAGG - Intergenic
1153278505 18:3392298-3392320 ACATAACCTGAGAGGAAGAGTGG - Intergenic
1153518236 18:5925206-5925228 ACATGGCAAGAGAGAGAGGGAGG + Intergenic
1156491464 18:37498775-37498797 ACCTGGCCTGGGAGGGAGGTGGG + Intronic
1157598251 18:48876731-48876753 ACATGGCCTGGGAGGGGTGGAGG - Intergenic
1157750645 18:50175089-50175111 AGATTCCCTGAGAGGCTGGGTGG - Intronic
1157825824 18:50811365-50811387 ACATTGCCTGAGGCTGGGGGAGG - Intronic
1158231419 18:55259942-55259964 ACACTACCTGAGAGAGATGGAGG + Exonic
1159307742 18:66667519-66667541 ACATGGCCAGAAAGGTAGGGGGG - Intergenic
1160744430 19:704055-704077 ACATTGCCTGGGATGCAGGGAGG + Intergenic
1161486993 19:4541680-4541702 ACATGGACTGAGAGGAAGGAAGG + Intergenic
1161544241 19:4870279-4870301 ACAGTGAGTGAGAGAGAGGGAGG + Intergenic
1161911556 19:7198213-7198235 CCATTGGCTGAGCGCGAGGGCGG - Intronic
1162797672 19:13095196-13095218 GCCTTGGCAGAGAGGGAGGGAGG - Exonic
1164669289 19:30063607-30063629 AAAATGACAGAGAGGGAGGGAGG - Intergenic
1165148890 19:33749687-33749709 ACAGTGCCTGGGAGGGAGGTGGG - Intronic
1165882091 19:39051523-39051545 ACATTGCCTGCCAGGGACGGTGG + Intergenic
1166142776 19:40813894-40813916 ACAGAGACTGAGAGTGAGGGAGG - Intronic
1167019024 19:46860903-46860925 CCATTGCGAGGGAGGGAGGGAGG + Intergenic
1167169484 19:47821791-47821813 ACATTGGCTGGGAGGGGGAGGGG - Intronic
1167170000 19:47824617-47824639 ACTGAGCCTGGGAGGGAGGGAGG - Intronic
1168153650 19:54461808-54461830 ACATGGCAGAAGAGGGAGGGAGG - Exonic
926733737 2:16057135-16057157 ACAAGGGGTGAGAGGGAGGGAGG - Intergenic
927946547 2:27138179-27138201 ACGGTGGTTGAGAGGGAGGGAGG + Exonic
928377534 2:30787796-30787818 ACATTGCCAGAAAGGTAGGTTGG + Intronic
928885155 2:36139951-36139973 ACTTTGCAGGAAAGGGAGGGAGG + Intergenic
929171207 2:38934681-38934703 ACAGTGCCTGAGATGGAGGGAGG - Intronic
929554014 2:42913164-42913186 ACAATGCCTGGGAATGAGGGTGG + Intergenic
930545161 2:52758347-52758369 AGATTCCTTGAGAGGGAGGATGG - Intergenic
930692938 2:54383031-54383053 ACCTCATCTGAGAGGGAGGGAGG - Intronic
931117927 2:59184526-59184548 CCTTTGCATGAGGGGGAGGGAGG + Intergenic
931185525 2:59947363-59947385 ACTTTGCCTGAAAGGGAGGAAGG - Intergenic
932428599 2:71659709-71659731 TCATTGCCTGAGATGGAGAGGGG + Intronic
932490361 2:72116204-72116226 ACAGTGCCTGGGAGGCTGGGAGG - Intergenic
932775070 2:74523531-74523553 AAATTTCCTGAGAAGAAGGGTGG + Exonic
933333872 2:80929363-80929385 GGATTGCGAGAGAGGGAGGGAGG - Intergenic
933865173 2:86509494-86509516 AAATTCCCTGAGAGGAAGGGAGG + Intronic
934671596 2:96217257-96217279 ACATTGCCTGAGAGCACAGGGGG - Intergenic
934883942 2:98008065-98008087 ACAGAGCCGGCGAGGGAGGGGGG + Intergenic
934921728 2:98349184-98349206 ACCTGGCCTGAAAGGGAGGCTGG + Intronic
936234233 2:110730004-110730026 ACATTGGCTTAGAGGCTGGGAGG - Intergenic
938843210 2:135182483-135182505 ACATTTCCTGATTTGGAGGGAGG + Intronic
938933882 2:136111810-136111832 ACACAGCCTCAGAGGGAGGCTGG - Intergenic
939856577 2:147365920-147365942 ATTTTGCAAGAGAGGGAGGGAGG - Intergenic
940111864 2:150163538-150163560 GAGTTGCCTGAGAGGGATGGAGG + Intergenic
940133701 2:150412561-150412583 ACATGGCCTCAGAGTCAGGGAGG - Intergenic
940374860 2:152946342-152946364 ACATGGCAAGAGAGGGAGTGAGG - Intergenic
941137769 2:161738903-161738925 ATATTGCCTGAGAGTGAAGATGG - Intronic
943074826 2:183180990-183181012 TCATTGCCTCAGATGGAGGTAGG - Intergenic
943548235 2:189308204-189308226 CCCTTGGCTGAGAGGGAGGGGGG - Intergenic
944149207 2:196539255-196539277 ACATTTCCTGTGAGGAAGGATGG - Intronic
944434906 2:199677552-199677574 GCATTGCCTAAGAGAGATGGTGG + Intergenic
946256922 2:218449153-218449175 ACGGTGCCTGAGGGTGAGGGAGG + Intronic
946343809 2:219091425-219091447 ACATTGGCTGGGGTGGAGGGTGG + Intronic
946946048 2:224823981-224824003 CTATTCCCTGAGAGGGAAGGAGG - Intronic
947386053 2:229591648-229591670 CCGTTGCCTGAGAGCGAGGCAGG + Exonic
947389518 2:229624754-229624776 AGACTGCCTGGGAGTGAGGGTGG - Intronic
947493379 2:230614999-230615021 ACGTTGCCTGGGAGGGTGAGTGG + Intergenic
948106969 2:235421981-235422003 TCCTGTCCTGAGAGGGAGGGAGG + Intergenic
948636542 2:239341466-239341488 ACACTACCTAACAGGGAGGGAGG + Intronic
948710613 2:239822740-239822762 ACATGGCCGGAGAGGGAGGAAGG - Intergenic
1169189385 20:3648186-3648208 CCTTGGTCTGAGAGGGAGGGTGG - Exonic
1169409447 20:5355139-5355161 ACATGGCCTGAGAGTGGGGAAGG - Intergenic
1172197511 20:33102179-33102201 GCGGTGCCTGAGAGGGAGAGAGG + Intronic
1172604327 20:36204384-36204406 ACAATGCCTGGGAGGGATGATGG - Intronic
1172696772 20:36828326-36828348 ACAGCCCCTGAGAGAGAGGGAGG - Intronic
1172811155 20:37649378-37649400 ACAGAGGCTGAGAGTGAGGGAGG - Intergenic
1172945062 20:38680923-38680945 ATCGTTCCTGAGAGGGAGGGTGG - Intergenic
1172970057 20:38866631-38866653 AGATGGCCTGGGATGGAGGGTGG + Intronic
1173068944 20:39742668-39742690 CCATTGCCTTATAGGGAGGGTGG + Intergenic
1173598033 20:44272381-44272403 TCATTGGCTGAGAGGGAGCTGGG + Intronic
1173631871 20:44522143-44522165 TCATTGGCTGAGGGGGAAGGTGG + Intergenic
1173864484 20:46305569-46305591 GCATGGCCTGGGAGGGAGTGAGG - Intronic
1174114589 20:48218247-48218269 ACAGTGGCTGAGAGGGCGAGGGG - Intergenic
1174562674 20:51442785-51442807 CCACAGCCTGAGAGGGAGGCTGG + Intronic
1174797194 20:53532003-53532025 GCATTTCCTGGGAGGGAGAGGGG + Intergenic
1174872531 20:54196344-54196366 ACATGGACTGATAGGGAGGAAGG + Intergenic
1176365744 21:6031829-6031851 TACTTGGCTGAGAGGGAGGGAGG + Intergenic
1179757772 21:43506716-43506738 TACTTGGCTGAGAGGGAGGGAGG - Intergenic
1181447272 22:22986908-22986930 GCAAGGCCTGAGAGGGAAGGAGG - Intergenic
1181821749 22:25481516-25481538 ACAATGCCTGAGGGGGACAGTGG + Intergenic
1181849820 22:25742100-25742122 ACATTGGCCCAGAAGGAGGGTGG + Intergenic
1181940038 22:26468582-26468604 ACCTTGGCGGTGAGGGAGGGCGG + Exonic
1183348047 22:37318783-37318805 ACATTGCCAGACAGGGAGGGAGG - Intergenic
1183727394 22:39597349-39597371 AGTTGGCCTGGGAGGGAGGGAGG + Intronic
1184530969 22:45055483-45055505 ACATTTACTGAGCGGGAGTGGGG + Intergenic
1185284759 22:49995270-49995292 GAATTGTCTGAGAGGGAGGCTGG + Exonic
1185366088 22:50437490-50437512 AGAAGGCCTGGGAGGGAGGGAGG - Exonic
949332589 3:2938716-2938738 TCATTTCCTGAGAGGGAGAGAGG + Intronic
949888461 3:8714399-8714421 ACAGTGCCTGGGACTGAGGGTGG - Intronic
949894176 3:8757027-8757049 ACACTGGCTGAGAGGCAGGGAGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950363796 3:12468825-12468847 ACATTGATAGGGAGGGAGGGAGG + Intergenic
950722339 3:14892141-14892163 AAAGTGCCTGAGAGAGAGGATGG - Intronic
952038220 3:29230445-29230467 AGATTGCTTGAGAGTGTGGGAGG - Intergenic
952057087 3:29460784-29460806 ACAGTGCTAGAGAGGGAGGCTGG + Intronic
952126531 3:30307006-30307028 ACATGGCGAGAGAGGGAGGAAGG + Intergenic
953663225 3:44906048-44906070 ATAAGGCCAGAGAGGGAGGGTGG + Intronic
954543557 3:51413381-51413403 ACATAGCTTGAGGGGGAGTGGGG + Exonic
955069102 3:55557374-55557396 AGGTTCCCTGAGAGGAAGGGAGG - Intronic
956369342 3:68541261-68541283 AAATTTCTTGAGAAGGAGGGAGG - Intronic
956659130 3:71582272-71582294 ACGTTGTCTGAAAAGGAGGGAGG + Intronic
958197150 3:90255905-90255927 GGATTGCCTGAGCTGGAGGGCGG + Intergenic
958556701 3:95687468-95687490 ACATTGCATGAGAGTAAGGGTGG - Intergenic
960670285 3:120148922-120148944 CCCTTGCATGAGAGGGAGGAAGG - Intergenic
960713004 3:120549786-120549808 ACATTGCCTCCCAGGGTGGGTGG + Intergenic
961032570 3:123619323-123619345 ACATAGCCTGAAGGGAAGGGAGG - Intronic
961103106 3:124218698-124218720 ACTTTTCTGGAGAGGGAGGGCGG + Intronic
961144583 3:124583629-124583651 ACATGGCCTGAGAAGGGAGGAGG + Intronic
961333513 3:126156674-126156696 ACATGGCCTGAGCGGCAGGGCGG - Intronic
961364699 3:126391910-126391932 ACGTTCCCAGAGAGGGAGGGGGG + Intergenic
962835883 3:139187994-139188016 ACATAGCCTGAGCTGGAGGCAGG + Intronic
962836120 3:139190193-139190215 ACATAGCCTGAGCTGGAGGCGGG + Intronic
965642316 3:170842936-170842958 CCATTGTCTGAGAGAGAAGGAGG - Intronic
966569790 3:181428753-181428775 ACATGGCAAGAGAGTGAGGGGGG + Intergenic
967506974 3:190263479-190263501 AAACTGGTTGAGAGGGAGGGTGG + Intergenic
968476100 4:809515-809537 ACATGGCCTGAGGGGGTGGGGGG + Intronic
969017452 4:4113400-4113422 AACTTGACTGAGAGAGAGGGAGG + Intergenic
969149280 4:5154923-5154945 ACATATCCCGAGTGGGAGGGAGG - Intronic
969251936 4:5973835-5973857 TCTTGGCCTGAAAGGGAGGGAGG + Exonic
970225511 4:13852577-13852599 ACATTCCCTGACATGAAGGGAGG + Intergenic
970402745 4:15733656-15733678 ACATGGCCAGAGAAGGAGGAAGG + Intronic
970531942 4:16993850-16993872 ACCTTGACTGACAGGTAGGGTGG - Intergenic
970900227 4:21150326-21150348 CCAATGGCTGAGAGGGAGGCAGG + Intronic
971403686 4:26300588-26300610 TCAGTGCTAGAGAGGGAGGGAGG - Intronic
973063418 4:45758467-45758489 ACATTGACTGAGAGTGGTGGAGG + Intergenic
976589479 4:86834870-86834892 ACATGGCCAGAGAGGGAGCAAGG + Intronic
977079528 4:92506996-92507018 ACATAGCCTGAGCAGGAGGCAGG - Intronic
979057331 4:116013932-116013954 ACATTGGGTGGGGGGGAGGGGGG - Intergenic
979752167 4:124291981-124292003 ACATGGCAAGAGAGGGAGCGGGG - Intergenic
979788973 4:124754282-124754304 AAATTGCCTAAGATGGAAGGAGG - Intergenic
981391325 4:144195084-144195106 ATATTGCATGAGTGGGAGTGAGG + Intergenic
982176906 4:152714465-152714487 TCATGGCCTGAGAGAGAGGTTGG - Intronic
982349654 4:154400750-154400772 ACGTTACATGAGAGAGAGGGAGG - Intronic
986151833 5:5137115-5137137 GCATTGGCAGAGAGGAAGGGTGG + Intergenic
987013509 5:13793372-13793394 ACACTGCTTGAGAGTGATGGAGG + Intronic
988544085 5:32140763-32140785 CCATTGCCTGGGCAGGAGGGTGG - Intronic
990553512 5:56908425-56908447 TCTTTGCCTGAGAGTGAGGTTGG - Intergenic
990868285 5:60403372-60403394 ACATTTCCTGAGAGTGTAGGTGG - Intronic
990992475 5:61699412-61699434 ACCTTGCCTGAGTGTCAGGGAGG - Intronic
991413371 5:66367027-66367049 ACATTCTCTGAGAGCGATGGAGG + Intergenic
995015764 5:107306906-107306928 ACGTTGGCAGAGATGGAGGGAGG + Intergenic
996094860 5:119387771-119387793 ACAGAGACAGAGAGGGAGGGAGG + Intronic
996126328 5:119729010-119729032 ACATGGCCAGAGCAGGAGGGTGG - Intergenic
997621155 5:135297015-135297037 CCTGTGCCTGAGATGGAGGGAGG - Intronic
998131544 5:139653848-139653870 ACAGGGCCTAGGAGGGAGGGAGG + Intronic
998302791 5:141041135-141041157 ACAATGCCAGAGGTGGAGGGGGG - Intergenic
998464351 5:142331430-142331452 ACACTGCATGGGAGGGATGGCGG + Intergenic
998675215 5:144400319-144400341 CCAGAGCCTGAGAGGGAGGAAGG + Intronic
998947252 5:147352910-147352932 ATATAGCCTGGAAGGGAGGGAGG + Intronic
999312355 5:150559617-150559639 AGATAGCCTGAGAGACAGGGAGG - Intergenic
999418939 5:151424121-151424143 AGAGTGGTTGAGAGGGAGGGTGG - Intergenic
1001858602 5:175033773-175033795 ACCTTGGCTGGGAGGGAGGGAGG + Intergenic
1002401976 5:178996012-178996034 ACACTGCCTTGGATGGAGGGAGG + Intronic
1002723876 5:181282224-181282246 ACACTGCCTAAGGGGGCGGGGGG + Intergenic
1003011068 6:2428075-2428097 AGATGGCCTGGGAGTGAGGGTGG - Intergenic
1003015244 6:2462700-2462722 ACATGGCCTGAGAGGAGGAGAGG - Intergenic
1005525137 6:26640018-26640040 ATAATGCAGGAGAGGGAGGGTGG - Intronic
1006350278 6:33515989-33516011 ACATTGACTGGGAGGGAGGAGGG - Intergenic
1007244447 6:40450456-40450478 ACATTGCAAGGGAGAGAGGGAGG + Intronic
1008307846 6:49926735-49926757 ACATTGCCTGAGGTGGAGGTAGG + Intergenic
1008505779 6:52228360-52228382 ACTCTGCATGAGAGGGAGGCAGG - Intergenic
1010686165 6:78857402-78857424 ACAATGCCTGACAGGAAGGAAGG + Intergenic
1011037770 6:82996646-82996668 ACATTGCCGGTGATGGAAGGTGG + Intronic
1011470084 6:87700570-87700592 ACATTTCCTGAGAGAGACTGGGG - Intronic
1012963687 6:105649500-105649522 ACTTAGCCTGAGAGGGAAGAAGG - Intergenic
1014021383 6:116594083-116594105 ACATGGCCAGAGAGTGAGGGTGG + Exonic
1014082182 6:117300510-117300532 TAGTTGCCTGACAGGGAGGGAGG + Intronic
1014256166 6:119161674-119161696 ACAGAGCCTGAGAGGGTGTGAGG + Intergenic
1016980852 6:149852517-149852539 ACCGAGCCTGTGAGGGAGGGAGG - Intronic
1017943238 6:159071780-159071802 AAACAGGCTGAGAGGGAGGGTGG + Intergenic
1018501808 6:164419313-164419335 ATATTGACTCAGAGGGAGGTAGG + Intergenic
1018834415 6:167472272-167472294 ACAGTGCCTGCGAGGGATGTAGG - Intergenic
1019525154 7:1477420-1477442 ACATGGCCTGAGAGCAGGGGGGG + Intronic
1020104101 7:5413188-5413210 ACAGTACATGAGAGGGTGGGAGG + Intronic
1020590090 7:10124654-10124676 ACATTGGGAGAGAGAGAGGGAGG - Intergenic
1021614275 7:22486739-22486761 GACTTGCCTGAGAGGGAGTGAGG - Intronic
1022092673 7:27117760-27117782 AGATTGCCTGGGAGGGGTGGGGG - Intronic
1022196571 7:28073389-28073411 CCCTTGCCTGAGAGAAAGGGAGG - Intronic
1022516386 7:30977386-30977408 ACAGGGCCTGAGTGGGAGAGAGG - Intronic
1022907508 7:34871219-34871241 ACATGGCAAGAGAGAGAGGGAGG + Intronic
1023130601 7:36999107-36999129 GCATTGTCTAGGAGGGAGGGTGG + Intronic
1023329477 7:39099376-39099398 AAATTCCCTTGGAGGGAGGGAGG - Intronic
1023641745 7:42265601-42265623 AAATTCCCTGAGAGGGACAGTGG - Intergenic
1023740516 7:43277188-43277210 CCATTGCCTGAGTAGGAGGATGG - Intronic
1024315154 7:48009367-48009389 ACACAGTCTGAGAGGGAGGTTGG + Intronic
1024422007 7:49179211-49179233 AAATTGAGAGAGAGGGAGGGAGG - Intergenic
1026411535 7:70127941-70127963 AGATTTCAAGAGAGGGAGGGAGG - Intronic
1026548332 7:71344687-71344709 ACATTGCCAGAGAGAGAAGAGGG + Intronic
1028831075 7:95327149-95327171 ACATGGCAAGAGAGGGAGTGGGG - Intergenic
1030107540 7:105999600-105999622 CCACTGCCTGAGAAGGAAGGAGG + Intronic
1030405060 7:109100357-109100379 ATATTGCCTGAGAGATAGTGGGG - Intergenic
1032945808 7:136851379-136851401 TCAATGCATGGGAGGGAGGGAGG + Intergenic
1033021211 7:137726134-137726156 CCATTGCCTGAGAGGGGAGAAGG - Intronic
1033206593 7:139428390-139428412 AAATTAGCTGAGTGGGAGGGTGG - Intergenic
1034410799 7:150941150-150941172 ACATTGCCAGTGAAGGAGTGGGG + Intergenic
1035683684 8:1507815-1507837 AGGATGCCTGGGAGGGAGGGTGG - Intronic
1036153457 8:6320177-6320199 ACATTGCCTGTGAGGAAGAATGG + Intergenic
1036432006 8:8700448-8700470 CCAGGGCCTGTGAGGGAGGGAGG + Intergenic
1037710756 8:21353530-21353552 ACAGTGCCTGAGCAGGTGGGGGG + Intergenic
1038278521 8:26141866-26141888 ACATGGCCAGAGAGGGAGCAAGG - Intergenic
1038875000 8:31538817-31538839 GCATTTCCTGAGAGTTAGGGTGG + Intergenic
1039176873 8:34818342-34818364 ACATTGCCTCAGAGAGAGCTTGG - Intergenic
1041044395 8:53877630-53877652 ACCTTGCCAGAGAGCGGGGGAGG + Intronic
1042841224 8:73125722-73125744 ACATAGCCTGTGGGGTAGGGGGG - Intergenic
1043324007 8:79027191-79027213 ACATTCTCAGATAGGGAGGGAGG + Intergenic
1043724967 8:83599826-83599848 ACATAGCCTGGAAGGGAGGGTGG + Intergenic
1044767907 8:95596859-95596881 CCACAGCATGAGAGGGAGGGTGG + Intergenic
1044959690 8:97518170-97518192 AGAATGCCCGAGAGGGAGTGTGG - Intergenic
1045320847 8:101080541-101080563 ACACTGCTTGACAAGGAGGGCGG - Intergenic
1047287928 8:123504443-123504465 TCAGTGCCTGGGAGGGTGGGGGG - Intronic
1048388196 8:133933374-133933396 ACATTGCCTGGGGGTGGGGGAGG + Intergenic
1048574657 8:135681190-135681212 ACATAGCCTCTCAGGGAGGGAGG - Intergenic
1049934220 9:485111-485133 ACAGTGACTGACAGTGAGGGTGG - Intronic
1051407560 9:16755222-16755244 ACATGGCCTCAAATGGAGGGAGG + Intronic
1051938939 9:22481035-22481057 ACACTGCCTGTGAGTGTGGGAGG - Intergenic
1056083564 9:83122549-83122571 AGATTGCGTGAGAGAGCGGGAGG + Intergenic
1056316542 9:85395864-85395886 ACATGGCCTCAGATGGAAGGTGG + Intergenic
1056335396 9:85563753-85563775 GAATTGCCTGTCAGGGAGGGTGG - Intronic
1057068967 9:92079600-92079622 AGATTGCCTGGGGTGGAGGGAGG - Intronic
1057777579 9:98023373-98023395 ACATTGCCTTATAAGGAGTGGGG - Intergenic
1059308081 9:113370172-113370194 ACATGGCCTGAAAGGGTGGTGGG - Exonic
1059519913 9:114931428-114931450 ACATTGCCTGCCTCGGAGGGTGG - Intergenic
1060128682 9:121074888-121074910 ACAGTACCGGAGAGGGAGAGGGG + Intronic
1060948018 9:127581805-127581827 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948032 9:127581859-127581881 ACATGGGATGAGAGGGAGGGAGG - Intergenic
1060948040 9:127581886-127581908 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948049 9:127581913-127581935 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948073 9:127581990-127582012 ACATGGGATGAGAGGGTGGGAGG - Intergenic
1060948081 9:127582017-127582039 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948090 9:127582044-127582066 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948099 9:127582071-127582093 ACATGGGATGAGAGGGAGGGAGG - Intergenic
1061278754 9:129584984-129585006 ACTTTGCCTCAGAGAGAGGAAGG - Intergenic
1061753265 9:132795366-132795388 ACATTGCCTGTGAGGAACTGGGG + Intronic
1062010134 9:134262383-134262405 AAATGGCCTGAGAGGTCGGGGGG - Intergenic
1186261407 X:7783661-7783683 ACAGTGCCTGGGAGGGATAGGGG - Intergenic
1186735272 X:12456524-12456546 CCTTTGACAGAGAGGGAGGGAGG - Intronic
1186788072 X:12971807-12971829 ACATTGCCTGCGTTGAAGGGCGG - Intergenic
1187567389 X:20464988-20465010 ACATCGGGTGAAAGGGAGGGTGG - Intergenic
1188573325 X:31616153-31616175 ACATTGCATTAGAGAGAGGCTGG - Intronic
1189216273 X:39327543-39327565 ATATTGCTGGAGAAGGAGGGAGG - Intergenic
1189279786 X:39813048-39813070 ACAATGCCTGTGAGGGAGAAAGG + Intergenic
1189578353 X:42379706-42379728 AAAGTGCAGGAGAGGGAGGGTGG + Intergenic
1192180717 X:68914085-68914107 ACACTGCCTGGTAGGTAGGGTGG - Intergenic
1192677678 X:73215415-73215437 ACATTTCCTGTGAGGGGAGGAGG + Intergenic
1198420558 X:136467532-136467554 ACATTGCCTGTTAAGAAGGGAGG - Intergenic
1198799103 X:140431632-140431654 AAATTGCCTGGGAGGGACTGTGG - Intergenic
1199924843 X:152451372-152451394 AAACTGACAGAGAGGGAGGGAGG - Intergenic