ID: 903327825

View in Genome Browser
Species Human (GRCh38)
Location 1:22581391-22581413
Sequence GTTCACCTGGGACAAATAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903327825_903327830 24 Left 903327825 1:22581391-22581413 CCAATTATTTGTCCCAGGTGAAC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 903327830 1:22581438-22581460 AAGACCTGCCCTCCTGTCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 192
903327825_903327828 -2 Left 903327825 1:22581391-22581413 CCAATTATTTGTCCCAGGTGAAC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 903327828 1:22581412-22581434 ACTGAACCACATCTGTCTGTAGG 0: 1
1: 0
2: 0
3: 9
4: 142
903327825_903327831 25 Left 903327825 1:22581391-22581413 CCAATTATTTGTCCCAGGTGAAC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 903327831 1:22581439-22581461 AGACCTGCCCTCCTGTCTTTGGG 0: 1
1: 0
2: 3
3: 17
4: 210
903327825_903327832 26 Left 903327825 1:22581391-22581413 CCAATTATTTGTCCCAGGTGAAC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 903327832 1:22581440-22581462 GACCTGCCCTCCTGTCTTTGGGG 0: 1
1: 0
2: 1
3: 25
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903327825 Original CRISPR GTTCACCTGGGACAAATAAT TGG (reversed) Intronic
903327825 1:22581391-22581413 GTTCACCTGGGACAAATAATTGG - Intronic
906581129 1:46935959-46935981 GTTGTTCTGGGATAAATAATGGG + Intronic
906602596 1:47142935-47142957 GTTGTTCTGGGATAAATAATGGG - Intronic
911395460 1:97301953-97301975 ATTAAACTGGGAAAAATAATGGG + Intronic
911888628 1:103337884-103337906 GATGGCCTGGGACAAATATTAGG - Intergenic
913552524 1:119929482-119929504 TTTGAGATGGGACAAATAATAGG - Intronic
916452217 1:164931687-164931709 TGTGACCAGGGACAAATAATTGG + Intergenic
918876599 1:190053847-190053869 ATTCAACTGGGACAAATGAATGG + Intergenic
920539231 1:206765423-206765445 GTTAACCTGGGAGAAAACATAGG - Intergenic
921781639 1:219172453-219172475 GATTACCTGGAACAAATAAAAGG + Intergenic
1072258174 10:93641008-93641030 CTTCATCTGGTACAAATTATTGG - Exonic
1078012847 11:7586793-7586815 GTTCAGCTGGGCCAAATGAGGGG + Intronic
1079004693 11:16783436-16783458 GGTCACTTGGGACACAGAATTGG + Intronic
1080335716 11:31193620-31193642 CTTTACCTTGGAAAAATAATAGG + Intronic
1085047858 11:73363710-73363732 ATGCACCTGGGACAAATGCTTGG - Intronic
1085608249 11:77922377-77922399 GTTCAGCTGTGTCAAAAAATGGG + Exonic
1087933967 11:104009895-104009917 GTCCTCCTGGGACTATTAATAGG + Intronic
1089464760 11:118677919-118677941 GTGTACCTGGGATAATTAATAGG - Intronic
1094323032 12:29206331-29206353 GTTTACCTGATACAAATACTTGG + Intronic
1095106751 12:38243137-38243159 GTTCAACTGGGATATAGAATAGG + Intergenic
1095496662 12:42791601-42791623 CTTGACCTTAGACAAATAATTGG + Intergenic
1095791658 12:46174579-46174601 GTTCACCTGGGACCTAGCATGGG - Intergenic
1096676363 12:53228317-53228339 CGTCACTTGGGACTAATAATAGG + Intronic
1099034692 12:77571365-77571387 GTACAACTAGGAGAAATAATGGG + Intergenic
1106814982 13:33397652-33397674 GGCCTCATGGGACAAATAATGGG + Intergenic
1107952159 13:45473203-45473225 GCTCACCTGTGGCAAATCATGGG - Intronic
1108756247 13:53505725-53505747 GTTAACATGGGAGAAATAAAAGG - Intergenic
1110824509 13:79957153-79957175 TTTCAGTTGGGATAAATAATAGG + Intergenic
1111497595 13:89072570-89072592 ATTCACCTGAGACAGATTATTGG + Intergenic
1118101856 14:62614591-62614613 GTTCACCTGAGAAAATTCATGGG - Intergenic
1120051011 14:79866193-79866215 GTTCAACTGGGACAAACACAGGG - Intronic
1126706521 15:51410957-51410979 TATCACCTGGGACAAGGAATTGG + Intergenic
1129163643 15:73762390-73762412 GTTATGCTGTGACAAATAATGGG - Intergenic
1130533523 15:84766368-84766390 GATCACCAGGGACATACAATAGG + Intronic
1130701038 15:86182116-86182138 GTTTCGGTGGGACAAATAATTGG + Intronic
1131484214 15:92807159-92807181 TTTTACCTGGAACAAGTAATAGG + Intronic
1133399837 16:5477565-5477587 GTTGGCATGGGACAACTAATAGG + Intergenic
1137655639 16:50155402-50155424 GTTCACATGGGATTACTAATTGG - Intronic
1137817735 16:51415122-51415144 GTTCAAATGGGACTAATCATGGG - Intergenic
1139269971 16:65672666-65672688 AATCACCTGGGACAACTAAAAGG + Intergenic
1140688851 16:77461762-77461784 ATTCACCTGAGAGAAAGAATTGG + Intergenic
1141540029 16:84713075-84713097 GTTCACTGGTGACACATAATTGG - Intronic
1144415380 17:15041539-15041561 ATTCAACTGGGACAAGTCATAGG - Intergenic
1149671457 17:58416430-58416452 TTTTAACTGGGAAAAATAATTGG - Exonic
1151143720 17:72019509-72019531 GATCACCTGTGACAAAGAAAAGG + Intergenic
1151790809 17:76304682-76304704 GCTCACATGGGACAGATAACTGG - Intronic
1159625094 18:70683739-70683761 ATTCACCTAGGAAAAAAAATTGG + Intergenic
1159953655 18:74504243-74504265 GTGCCGCTGGGACAAATGATGGG + Intronic
925871743 2:8277805-8277827 GACCACCGGGGACAAATAGTGGG + Intergenic
928635530 2:33241758-33241780 TTTTACTTGGGACATATAATAGG + Intronic
929981631 2:46686833-46686855 CTTCACGTGGGACAAATATTTGG - Intergenic
932504492 2:72215596-72215618 GCTTACCTGGGACAGATGATGGG + Intronic
932575034 2:72958139-72958161 GTTCCTCTGGGGCATATAATGGG - Intronic
934985121 2:98879672-98879694 GTGCACCTGGGACAGCTACTCGG - Intronic
936160441 2:110080563-110080585 ATGCACCTGGGACAAATGAGGGG - Intergenic
936184223 2:110290791-110290813 ATGCACCTGGGACAAATGAGGGG + Intergenic
943589234 2:189778053-189778075 GTTGACCATGGACAAATGATTGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1177709263 21:24750352-24750374 GTACAAGTGGGACAAAAAATAGG + Intergenic
1178108670 21:29349338-29349360 GTGTAGCTGGGAAAAATAATAGG - Intronic
1181343756 22:22202124-22202146 GTACACCTGGCAGTAATAATCGG - Intergenic
953624033 3:44555909-44555931 GTGCACATGGCACACATAATTGG - Intronic
955242045 3:57186843-57186865 GTTCACAGAGGACAAATTATTGG + Intergenic
957625906 3:82651418-82651440 GTTCACTGGTGACAAATATTTGG - Intergenic
959337258 3:105081564-105081586 GATCACCTGGGAAAAATCTTAGG - Intergenic
959608393 3:108267011-108267033 GTTCAGGTGGGAAAAAAAATGGG + Intergenic
965578577 3:170243933-170243955 GTTCACCTGGGAGAAACCCTTGG + Intronic
966287064 3:178310237-178310259 ATTTACCAGAGACAAATAATTGG + Intergenic
970503899 4:16707239-16707261 GAACACTTGTGACAAATAATAGG + Intronic
972997215 4:44895683-44895705 ATTCACCTGGAACAAATGTTTGG + Intergenic
979734068 4:124060774-124060796 GTTCATCTGGGACACATATTTGG - Intergenic
980883096 4:138733152-138733174 TTTCACCTGGGACCAATAACAGG - Intergenic
985227479 4:187778189-187778211 GTTGGCCTGGGACAAATCAGTGG + Intergenic
985331664 4:188843950-188843972 GTTCACTTGAGACAAATAGAAGG + Intergenic
987638654 5:20581672-20581694 GTGCACCTGGGACATATTCTAGG + Intergenic
991127068 5:63081366-63081388 GATCACCTGGGACAGAGAATGGG - Intergenic
999807740 5:155098883-155098905 GTTCACCAAGAACAAGTAATAGG + Intergenic
1000232993 5:159332521-159332543 CTCCACCAGGGACAAGTAATAGG + Intergenic
1000678833 5:164158046-164158068 GTTCATTTGGGAGAAATACTTGG + Intergenic
1003190396 6:3869545-3869567 TTTCACCTGGGCCAGATAATGGG + Intergenic
1003238846 6:4323745-4323767 GTTTACCTGTGGCAAATAAGTGG + Intergenic
1006994845 6:38249604-38249626 ATTCACCTAGGACACAGAATGGG + Intronic
1009326515 6:62356326-62356348 GTTCACCTAGCACAAAATATAGG + Intergenic
1009686002 6:66958639-66958661 GTTCATATGGAACCAATAATAGG - Intergenic
1013878285 6:114861752-114861774 TTTCACTTGAGAAAAATAATTGG - Intergenic
1025027013 7:55524936-55524958 GTTTGCCAGGGACAAATAAGAGG + Intronic
1025844649 7:65185462-65185484 GTTCAGCTGTGTCAAAAAATGGG - Intergenic
1025862325 7:65342678-65342700 TTTCTCCTGAGACAGATAATGGG + Intergenic
1025894978 7:65691800-65691822 GTTCAGCTGTGTCAAAAAATGGG - Intergenic
1037652558 8:20852173-20852195 GTTCACCTAAGAGATATAATGGG + Intergenic
1040896901 8:52377390-52377412 GTTGACATGGGCCAAATGATGGG + Intronic
1041119797 8:54574523-54574545 CATCACTTGGGACAAATATTGGG + Intergenic
1044185346 8:89244006-89244028 GCTCCCATGGGACAAAGAATTGG - Intergenic
1047330358 8:123881363-123881385 ATTCACCTATGGCAAATAATGGG + Intronic
1050331024 9:4546325-4546347 TATTACATGGGACAAATAATTGG - Intronic
1051283013 9:15462293-15462315 TTTCACCAGGGAACAATAATAGG - Exonic
1055703995 9:78978011-78978033 GTCAAGCTGGGACAAATAAGAGG - Intergenic
1057403846 9:94749529-94749551 GTACTTTTGGGACAAATAATTGG - Intronic
1058343615 9:103929899-103929921 TTTCACCTGGGATATATTATTGG - Intergenic
1060512241 9:124242541-124242563 GTTCACCTGGGACCCAGAAGAGG - Intergenic
1189576524 X:42359514-42359536 GTGCACCTGGTCCAAATAATTGG + Intergenic
1198320343 X:135513568-135513590 CTTCACCTGGGAAAAATAGCAGG + Intergenic
1198771960 X:140139787-140139809 ATTCTCCTGGAACAAATAAGTGG + Intergenic