ID: 903331872

View in Genome Browser
Species Human (GRCh38)
Location 1:22600708-22600730
Sequence CGCTGGCCGAGGAGAAGGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903331872_903331885 25 Left 903331872 1:22600708-22600730 CCGCACCTTCTCCTCGGCCAGCG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 903331885 1:22600756-22600778 GTGGGAGGTGCTGGCCTATGGGG 0: 1
1: 0
2: 4
3: 33
4: 336
903331872_903331883 23 Left 903331872 1:22600708-22600730 CCGCACCTTCTCCTCGGCCAGCG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 903331883 1:22600754-22600776 ATGTGGGAGGTGCTGGCCTATGG 0: 1
1: 0
2: 5
3: 26
4: 271
903331872_903331881 10 Left 903331872 1:22600708-22600730 CCGCACCTTCTCCTCGGCCAGCG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 903331881 1:22600741-22600763 CTTCGGCGTGGTCATGTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 70
903331872_903331884 24 Left 903331872 1:22600708-22600730 CCGCACCTTCTCCTCGGCCAGCG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 903331884 1:22600755-22600777 TGTGGGAGGTGCTGGCCTATGGG 0: 1
1: 0
2: 5
3: 24
4: 209
903331872_903331886 30 Left 903331872 1:22600708-22600730 CCGCACCTTCTCCTCGGCCAGCG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 903331886 1:22600761-22600783 AGGTGCTGGCCTATGGGGAGCGG 0: 1
1: 1
2: 5
3: 31
4: 291
903331872_903331876 -7 Left 903331872 1:22600708-22600730 CCGCACCTTCTCCTCGGCCAGCG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 903331876 1:22600724-22600746 GCCAGCGACGTGTGGAGCTTCGG 0: 2
1: 2
2: 3
3: 7
4: 86
903331872_903331879 6 Left 903331872 1:22600708-22600730 CCGCACCTTCTCCTCGGCCAGCG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 903331879 1:22600737-22600759 GGAGCTTCGGCGTGGTCATGTGG 0: 1
1: 0
2: 0
3: 7
4: 58
903331872_903331878 -2 Left 903331872 1:22600708-22600730 CCGCACCTTCTCCTCGGCCAGCG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 903331878 1:22600729-22600751 CGACGTGTGGAGCTTCGGCGTGG 0: 2
1: 0
2: 0
3: 1
4: 23
903331872_903331882 16 Left 903331872 1:22600708-22600730 CCGCACCTTCTCCTCGGCCAGCG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 903331882 1:22600747-22600769 CGTGGTCATGTGGGAGGTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 209
903331872_903331880 7 Left 903331872 1:22600708-22600730 CCGCACCTTCTCCTCGGCCAGCG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 903331880 1:22600738-22600760 GAGCTTCGGCGTGGTCATGTGGG 0: 1
1: 0
2: 0
3: 5
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903331872 Original CRISPR CGCTGGCCGAGGAGAAGGTG CGG (reversed) Exonic