ID: 903335403

View in Genome Browser
Species Human (GRCh38)
Location 1:22621171-22621193
Sequence TTGAGTAAGCAACCCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903335403_903335410 8 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335410 1:22621202-22621224 CATGGGCTACAGAGGGGCAGAGG No data
903335403_903335408 1 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335408 1:22621195-22621217 GCAAGCACATGGGCTACAGAGGG No data
903335403_903335405 -10 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335405 1:22621184-22621206 GCTTACTCAAGGCAAGCACATGG No data
903335403_903335411 9 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335411 1:22621203-22621225 ATGGGCTACAGAGGGGCAGAGGG No data
903335403_903335406 -9 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335406 1:22621185-22621207 CTTACTCAAGGCAAGCACATGGG No data
903335403_903335412 17 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335412 1:22621211-22621233 CAGAGGGGCAGAGGGAGCAGAGG No data
903335403_903335407 0 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335407 1:22621194-22621216 GGCAAGCACATGGGCTACAGAGG No data
903335403_903335409 2 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335409 1:22621196-22621218 CAAGCACATGGGCTACAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903335403 Original CRISPR TTGAGTAAGCAACCCCATCT TGG (reversed) Intergenic
No off target data available for this crispr