ID: 903335405

View in Genome Browser
Species Human (GRCh38)
Location 1:22621184-22621206
Sequence GCTTACTCAAGGCAAGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903335399_903335405 11 Left 903335399 1:22621150-22621172 CCATGATGGGAAACTGAGGCTCC No data
Right 903335405 1:22621184-22621206 GCTTACTCAAGGCAAGCACATGG No data
903335394_903335405 26 Left 903335394 1:22621135-22621157 CCTGCATGGTGCCATCCATGATG No data
Right 903335405 1:22621184-22621206 GCTTACTCAAGGCAAGCACATGG No data
903335397_903335405 15 Left 903335397 1:22621146-22621168 CCATCCATGATGGGAAACTGAGG No data
Right 903335405 1:22621184-22621206 GCTTACTCAAGGCAAGCACATGG No data
903335393_903335405 27 Left 903335393 1:22621134-22621156 CCCTGCATGGTGCCATCCATGAT No data
Right 903335405 1:22621184-22621206 GCTTACTCAAGGCAAGCACATGG No data
903335403_903335405 -10 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335405 1:22621184-22621206 GCTTACTCAAGGCAAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903335405 Original CRISPR GCTTACTCAAGGCAAGCACA TGG Intergenic
No off target data available for this crispr