ID: 903335407

View in Genome Browser
Species Human (GRCh38)
Location 1:22621194-22621216
Sequence GGCAAGCACATGGGCTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903335397_903335407 25 Left 903335397 1:22621146-22621168 CCATCCATGATGGGAAACTGAGG No data
Right 903335407 1:22621194-22621216 GGCAAGCACATGGGCTACAGAGG No data
903335399_903335407 21 Left 903335399 1:22621150-22621172 CCATGATGGGAAACTGAGGCTCC No data
Right 903335407 1:22621194-22621216 GGCAAGCACATGGGCTACAGAGG No data
903335403_903335407 0 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335407 1:22621194-22621216 GGCAAGCACATGGGCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903335407 Original CRISPR GGCAAGCACATGGGCTACAG AGG Intergenic
No off target data available for this crispr