ID: 903335409

View in Genome Browser
Species Human (GRCh38)
Location 1:22621196-22621218
Sequence CAAGCACATGGGCTACAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903335399_903335409 23 Left 903335399 1:22621150-22621172 CCATGATGGGAAACTGAGGCTCC No data
Right 903335409 1:22621196-22621218 CAAGCACATGGGCTACAGAGGGG No data
903335403_903335409 2 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335409 1:22621196-22621218 CAAGCACATGGGCTACAGAGGGG No data
903335397_903335409 27 Left 903335397 1:22621146-22621168 CCATCCATGATGGGAAACTGAGG No data
Right 903335409 1:22621196-22621218 CAAGCACATGGGCTACAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903335409 Original CRISPR CAAGCACATGGGCTACAGAG GGG Intergenic
No off target data available for this crispr