ID: 903335410

View in Genome Browser
Species Human (GRCh38)
Location 1:22621202-22621224
Sequence CATGGGCTACAGAGGGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903335399_903335410 29 Left 903335399 1:22621150-22621172 CCATGATGGGAAACTGAGGCTCC No data
Right 903335410 1:22621202-22621224 CATGGGCTACAGAGGGGCAGAGG No data
903335403_903335410 8 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335410 1:22621202-22621224 CATGGGCTACAGAGGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903335410 Original CRISPR CATGGGCTACAGAGGGGCAG AGG Intergenic
No off target data available for this crispr