ID: 903335412

View in Genome Browser
Species Human (GRCh38)
Location 1:22621211-22621233
Sequence CAGAGGGGCAGAGGGAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903335403_903335412 17 Left 903335403 1:22621171-22621193 CCAAGATGGGGTTGCTTACTCAA No data
Right 903335412 1:22621211-22621233 CAGAGGGGCAGAGGGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903335412 Original CRISPR CAGAGGGGCAGAGGGAGCAG AGG Intergenic
No off target data available for this crispr