ID: 903336303

View in Genome Browser
Species Human (GRCh38)
Location 1:22626896-22626918
Sequence CAGCCCACAAGCCCTGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903336303_903336306 8 Left 903336303 1:22626896-22626918 CCTAGGGCAGGGCTTGTGGGCTG No data
Right 903336306 1:22626927-22626949 ACCTCTCCTCTGTGTGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903336303 Original CRISPR CAGCCCACAAGCCCTGCCCT AGG (reversed) Intergenic
No off target data available for this crispr