ID: 903337424

View in Genome Browser
Species Human (GRCh38)
Location 1:22634478-22634500
Sequence CTTGCCATGATGCAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903337424 Original CRISPR CTTGCCATGATGCAGGTGAA GGG (reversed) Intergenic
900882814 1:5394113-5394135 CTTTCCATCCTGCAGCTGAAGGG - Intergenic
901041635 1:6367757-6367779 CTTGCCACGTTGCCAGTGAAGGG - Intronic
902515703 1:16988349-16988371 CTGGCCATGCTCGAGGTGAAGGG + Exonic
902814933 1:18910869-18910891 ATTGCTATTATGCAGGAGAAAGG - Intronic
902836376 1:19049545-19049567 CCTGCCAAGAAGCAGGGGAATGG + Intergenic
903042533 1:20542161-20542183 CCTGCCTTGGAGCAGGTGAAAGG + Intergenic
903337424 1:22634478-22634500 CTTGCCATGATGCAGGTGAAGGG - Intergenic
903667913 1:25019091-25019113 GTAACCATGATGCAGGCGAAGGG + Intergenic
904153926 1:28466475-28466497 CTTCTCATGAAGCAAGTGAAGGG + Exonic
904505413 1:30948975-30948997 TGTGCCACGATGCTGGTGAAGGG - Intronic
908403329 1:63790982-63791004 CTTTCCTTCATGCAGGAGAAAGG + Intronic
909470533 1:76022627-76022649 CTCTCCATGATGCTGGTAAATGG + Intergenic
911746005 1:101442503-101442525 CCTGCCTTGGAGCAGGTGAAAGG + Intergenic
913264578 1:117031937-117031959 ACTGCAATGATGCAAGTGAATGG - Intronic
916211694 1:162364988-162365010 CATGCCATGTTGGAGGTGGAAGG - Intronic
918272103 1:182912075-182912097 CCTGCCCTGGGGCAGGTGAAAGG - Intronic
919715322 1:200769903-200769925 CCTGCCTTGGGGCAGGTGAAAGG + Intronic
922342055 1:224665515-224665537 CTTGCCCTGATCCAGGTGCTTGG + Intronic
922945112 1:229507675-229507697 ATTGCCACGATGCAGATGTAAGG - Intronic
923804533 1:237243692-237243714 CCTGCCTTGGGGCAGGTGAAAGG + Intronic
924279358 1:242420530-242420552 CTTCTTATGATGCAGCTGAATGG + Intronic
1065854336 10:29817267-29817289 CTGGCCAGGAGGCTGGTGAATGG + Intergenic
1066397724 10:35042491-35042513 CCTGCCTTGAGGCAGGTGAAAGG - Intronic
1067018099 10:42772521-42772543 CTCCCCATGTTGCAGATGAAGGG + Intergenic
1069277607 10:66612121-66612143 ATTGTGATGATGGAGGTGAAAGG - Intronic
1070114772 10:73517635-73517657 CATGGCAGGAAGCAGGTGAATGG + Exonic
1070534678 10:77366954-77366976 TTTGCCATGATGCTGGTCACCGG + Intronic
1070772083 10:79088412-79088434 CTTGCCATGGTGCTGGGGGAGGG + Intronic
1071823333 10:89299773-89299795 CTGGCAAGGATGCAGGGGAAAGG + Intronic
1071940083 10:90580422-90580444 CTTGCCCTGATGCAGATCCATGG - Intergenic
1073150359 10:101307173-101307195 CTTGCCTGGAGGCAGGAGAATGG + Intergenic
1074709891 10:116168609-116168631 CTGGCCATGATCCACCTGAAGGG - Intronic
1076314693 10:129532185-129532207 CATGCCATGATGCTGGTCATGGG + Intronic
1077572469 11:3352161-3352183 CTTCCTATAATGCAGGTGTAAGG + Intronic
1077699910 11:4431778-4431800 CTTGCCAGTAAGCAGGTGAGTGG + Intergenic
1078068891 11:8095644-8095666 CGTGCCACGATGCAGAGGAAGGG + Exonic
1078378964 11:10822641-10822663 CCTGCCTTGGGGCAGGTGAAAGG - Intronic
1080633457 11:34102996-34103018 CTTGGCATGATGCTGGGCAAAGG - Intergenic
1082986833 11:59176259-59176281 CTTGCCATGATGCAGACACATGG - Intronic
1083572093 11:63766299-63766321 CTTGCCCTGAAGAAGGGGAAAGG + Exonic
1084182074 11:67451829-67451851 CTGGCCATGAGGCAGAGGAAGGG + Exonic
1084672613 11:70616185-70616207 TTTGACATGATGCAACTGAACGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088076290 11:105852813-105852835 CTTGTGATGATTCTGGTGAAAGG - Intronic
1088205031 11:107382804-107382826 CCTGCCTTGGGGCAGGTGAAAGG - Intronic
1088396233 11:109372818-109372840 CCTGCCATCAAGCAGGTGAGAGG + Intergenic
1089322550 11:117636195-117636217 GTAGCCATCATGCAGATGAAAGG - Intronic
1089467424 11:118694339-118694361 CCTGCCTTGATGCAGATGAAAGG + Intergenic
1091369012 11:135043359-135043381 CTGGCCACGCTGCAGGTGCAGGG + Intergenic
1092021889 12:5209664-5209686 ATTGCCATGATGGGGGTGGAAGG - Intergenic
1092495127 12:8985951-8985973 CCTGCCTTGAGGCAGATGAAAGG + Intronic
1093551209 12:20413767-20413789 TTCTCCATAATGCAGGTGAATGG - Intronic
1094603790 12:31933281-31933303 CCTGCCTTGAGGCAGGTGAAAGG + Intergenic
1094742236 12:33303183-33303205 CCTGCATTGAGGCAGGTGAAAGG - Intergenic
1096393598 12:51248602-51248624 CCTGCCTTGGGGCAGGTGAAGGG - Intronic
1100153551 12:91770734-91770756 CATGCCATGTTGCAGGTGGATGG + Intergenic
1101817160 12:108153955-108153977 CTTGCCTTGATGCTGCTGGAAGG + Intronic
1107516881 13:41138057-41138079 CCTGCCTTGGGGCAGGTGAAAGG - Intergenic
1111509455 13:89242049-89242071 CCTGCTATGGGGCAGGTGAAAGG + Intergenic
1113009050 13:105742406-105742428 CATGCCAAGAAGCAAGTGAAGGG - Intergenic
1113161672 13:107388793-107388815 CCTGCCGTGGTGCAGGTTAAAGG - Intronic
1113297903 13:108982236-108982258 CTTGCCATGAGGCAGGGGCGTGG + Intronic
1114192207 14:20448305-20448327 TATGCCATGATGCCAGTGAAGGG - Intronic
1115262648 14:31469667-31469689 CCTGCCTTGGGGCAGGTGAAAGG - Intergenic
1115726600 14:36224047-36224069 CTTGCATTGATGCACGTGCACGG - Intergenic
1115941626 14:38617190-38617212 CTTGCTCTGCAGCAGGTGAAGGG + Intergenic
1116947797 14:50852458-50852480 CTTGGCAGGATGAAGGTGTAGGG - Intergenic
1117296236 14:54381966-54381988 CTTGCTAGGATGCATGGGAATGG - Intergenic
1119507463 14:75185384-75185406 CCTGCCTTGGGGCAGGTGAAAGG - Intergenic
1123954981 15:25325843-25325865 CTTGAGATGATGCAGGTGCATGG - Intergenic
1127533175 15:59865048-59865070 CTTGCCTTGGAGCAGATGAAAGG - Intergenic
1128194365 15:65738028-65738050 CTTGCTATGAGCCAGGTGAGAGG + Intronic
1129183623 15:73892357-73892379 CTTGCCATGTTGCAGGTGACAGG + Intergenic
1130790274 15:87147431-87147453 CTGGCAAGGATGCAGGGGAAAGG + Intergenic
1131291006 15:91107012-91107034 TTTGCAATGATGTTGGTGAAGGG + Intronic
1131403915 15:92147890-92147912 CTTCCCCTGATTCAGATGAATGG - Intronic
1132022122 15:98371753-98371775 CTTGCCATAATGGAGGGGAAGGG - Intergenic
1133148504 16:3808507-3808529 CCAGCCCTGCTGCAGGTGAAGGG + Intronic
1134218500 16:12335019-12335041 CCTGCCAAGATGCATGTGAGGGG + Intronic
1135649998 16:24197673-24197695 CTTGCCATAATCCAGGCAAAAGG + Intronic
1135678750 16:24439325-24439347 CCTGCCTTGGAGCAGGTGAAAGG - Intergenic
1137587067 16:49670021-49670043 ACTGCCCTGATGCAGGGGAACGG - Intronic
1141902840 16:87003791-87003813 CTTGCAATGATGAAAGAGAAAGG - Intergenic
1142168635 16:88607788-88607810 CCTGACATGAAGCATGTGAATGG - Intronic
1142410749 16:89915417-89915439 CGTGCCAAGATGCAGCTGGAGGG - Intronic
1142869775 17:2812539-2812561 CATGCCAGGATGCTGGTGTAGGG + Intronic
1148193931 17:45699886-45699908 CTTCACATGTTACAGGTGAAGGG - Intergenic
1151432826 17:74076129-74076151 ATGGCCATGATGATGGTGAATGG + Intergenic
1153503455 18:5771315-5771337 CCTGCCTTTGTGCAGGTGAAAGG + Intergenic
1155168458 18:23249475-23249497 CTTGTCATGGTGCAGGTGCGAGG + Intronic
1156548747 18:37992235-37992257 ATTGCCATGATGAAGATGGATGG + Intergenic
1163738059 19:18993933-18993955 CTTGCCATCATGCAAGTGGAAGG - Exonic
1164717671 19:30405257-30405279 CCTGCCTTGGGGCAGGTGAAAGG + Intronic
1166128627 19:40731851-40731873 CCTGCCTTGGGGCAGGTGAAAGG + Intronic
1166888581 19:45975752-45975774 CTGGCCCTGCTGCAGGTGCACGG + Intergenic
1167029523 19:46948148-46948170 CCTGCCTTGTGGCAGGTGAAAGG + Intronic
1167869977 19:52360213-52360235 TCTGCCTTGAGGCAGGTGAATGG + Intronic
925356628 2:3246609-3246631 CTAGCCACCATGCAGGTGACGGG + Intronic
925763981 2:7213228-7213250 CTTGTTTTGACGCAGGTGAAAGG - Intergenic
926076935 2:9950287-9950309 ATTGCCATGATGCAGGCCGAGGG - Intergenic
926374035 2:12209214-12209236 CCTGCCTTGGTACAGGTGAAAGG - Intergenic
928293432 2:30060562-30060584 CATGCCATGCTGCAGGGGAATGG - Intergenic
930479281 2:51926451-51926473 CTTGCCATGTTGAAGCTGGAGGG - Intergenic
932014639 2:68011801-68011823 CCTGCCTTGGGGCAGGTGAAAGG + Intergenic
933897987 2:86828120-86828142 ATTGACATAATGCAGGTAAATGG + Intronic
936380070 2:111976373-111976395 CCTGCATTGAGGCAGGTGAAAGG + Intronic
936483775 2:112908916-112908938 CATGCCATTATGGAGTTGAAAGG - Intergenic
939061076 2:137421741-137421763 CCTGCCTTGGAGCAGGTGAAAGG + Intronic
941853643 2:170208375-170208397 CTTGCTAAGATGTAGGTGCATGG + Intronic
942297839 2:174534589-174534611 CCTGCCATGATGCTGAAGAAAGG + Intergenic
943215423 2:185027537-185027559 CTGGCAAGGATGCAGATGAAAGG + Intergenic
945219424 2:207468783-207468805 CCTGCCTTGGGGCAGGTGAAAGG + Intergenic
947537628 2:230950778-230950800 CCTGCCTTGCGGCAGGTGAAAGG - Intronic
947913832 2:233819387-233819409 CTTGTCATGCTGCAGGTTCATGG - Exonic
948658143 2:239489645-239489667 CTTGCCCTGGTGCAGCAGAAGGG + Intergenic
1169665731 20:8033485-8033507 CATTCCAAGATGCAGCTGAAGGG - Intergenic
1171287746 20:23955901-23955923 CTGTCCATCCTGCAGGTGAAAGG - Intergenic
1174200232 20:48801966-48801988 CATGCCATGATGCAGCAGGAAGG + Intronic
1174516325 20:51095233-51095255 TTGGCCATGCTGCAGGTGGATGG - Intergenic
1177948622 21:27505320-27505342 CTTGCAATGATGCTGCAGAACGG + Intergenic
1181920919 22:26319926-26319948 CTGGCTATGATGCACGTGGAGGG + Intronic
1183715547 22:39531257-39531279 CTTGCCATGAAGCAGGAGTGTGG - Intronic
952683983 3:36129265-36129287 CTTGCCAAGCTGCAGGTGGTGGG + Intergenic
953017524 3:39092471-39092493 CATCCCATGCTGCAGGTGCATGG - Intronic
953797714 3:45997985-45998007 CCTGCCTTAAAGCAGGTGAAAGG + Intergenic
954069992 3:48135934-48135956 CTTGCCATGTGGCAGATGAAAGG - Intergenic
954170266 3:48796224-48796246 CATGCCATTATGCAGAGGAAGGG - Intronic
955352755 3:58206167-58206189 CTTTCCCTGGTGCAGGTGAGGGG - Intronic
955868367 3:63409968-63409990 CTTCCCAGGATGCTAGTGAATGG - Intronic
958454155 3:94309021-94309043 CCTGCCTTGAGGCAGGTGAAAGG - Intergenic
960024996 3:112998633-112998655 CTTGTCTTGGAGCAGGTGAATGG + Intronic
961151027 3:124637943-124637965 TTTGGCATAATGCTGGTGAAAGG + Intronic
961640895 3:128364290-128364312 CTTGCCATGCTGACTGTGAATGG - Intronic
964434914 3:156641318-156641340 ATTGCCATGATGGATGTTAAAGG + Intergenic
965862858 3:173168346-173168368 CTTGTCATGATGCTAGTGAAAGG + Intergenic
967195363 3:187021387-187021409 CTTGCCTTGGGGCAGGTGAAAGG - Intronic
967339857 3:188384845-188384867 CTTTCCATGATGCATTTGAAGGG + Intronic
970070279 4:12150482-12150504 CTGGCCAAGATGCAGAGGAAAGG - Intergenic
971783162 4:31065195-31065217 ATTGCCAATATGCAGGTGAAAGG - Intronic
972628442 4:40822894-40822916 CTTGCGATGATGCTGGTGTGGGG + Intronic
972981643 4:44711397-44711419 GTTGTGATGATGCATGTGAAAGG - Intronic
975875271 4:78828550-78828572 CCTGCCTTGGGGCAGGTGAAAGG + Intronic
977572774 4:98646964-98646986 CGTGCCATTTTGCAGATGAAGGG + Intronic
978316227 4:107440468-107440490 ATTGCCATAATGCTGGAGAAAGG - Intergenic
979990229 4:127366700-127366722 CTTGCCTTGGGGCAGGTGAAAGG + Intergenic
980121865 4:128735637-128735659 CCTGCCTTGGGGCAGGTGAAAGG + Intergenic
988375817 5:30434445-30434467 CCTGCCATGAGGCATGTAAATGG - Intergenic
989069054 5:37490993-37491015 CGTGCCATGCTGCAGGTGCTTGG + Intronic
989730394 5:44641428-44641450 CTTGCCATGTTGTGGGTGACAGG - Intergenic
990169406 5:53030960-53030982 GTGGCCAGGATCCAGGTGAATGG + Intronic
992502562 5:77356883-77356905 CTTGCCCTTTTGCAGGTGACGGG + Intronic
992629427 5:78666235-78666257 CTTACCATGCTGCAGGGAAAGGG - Intronic
993190583 5:84674534-84674556 TCTGCCTTGAGGCAGGTGAAAGG - Intergenic
993391290 5:87321897-87321919 CCTGCCTTGGTGCAGATGAAAGG + Intronic
997667064 5:135638853-135638875 CTTGACAAGATGCAGAGGAAAGG - Intergenic
998749544 5:145304014-145304036 CTTGGAAATATGCAGGTGAAGGG + Intergenic
999432332 5:151535306-151535328 CTTGCTTTGGGGCAGGTGAAAGG - Intronic
999626131 5:153522280-153522302 CATGCCATGATACAGGTTACAGG - Intronic
999761150 5:154702181-154702203 CTGGCCAGAATGCAGGTGAGAGG - Intergenic
1000873567 5:166606820-166606842 GCTGCCATGATGCAGGGGCATGG + Intergenic
1001592128 5:172872934-172872956 CATGCCAAGATGCCTGTGAAAGG - Intronic
1003565888 6:7221694-7221716 CTTTTCAGGAGGCAGGTGAAGGG + Intronic
1006349331 6:33509492-33509514 CATGCCAGAATGGAGGTGAAGGG - Intergenic
1012092581 6:94918226-94918248 CTTACCATGATGGAGCTGCAGGG - Intergenic
1012953269 6:105541433-105541455 CCTGCCTTGGGGCAGGTGAAAGG - Intergenic
1017550884 6:155506063-155506085 CGTGCCAAGATGAAGGTGGAGGG + Intergenic
1018772805 6:166986663-166986685 CCTGCCTTGGGGCAGGTGAAAGG + Intergenic
1019001104 6:168752742-168752764 CCTGCCTTGGGGCAGGTGAAAGG + Intergenic
1019403528 7:869775-869797 CTTGCCAAGTTGCCTGTGAAAGG + Intronic
1020429879 7:8107904-8107926 CCTGCCATGATGCAGTGGGACGG - Intergenic
1021222591 7:17990933-17990955 CCTGCCTTGGAGCAGGTGAAAGG + Intergenic
1023069855 7:36418352-36418374 CCTGCCGTGGGGCAGGTGAAAGG + Intronic
1024805510 7:53135015-53135037 CTTGATATGATGCAGATCAAAGG + Intergenic
1025987140 7:66463726-66463748 CCTGCCTTGGGGCAGGTGAAAGG - Intergenic
1026045901 7:66905100-66905122 GTTGCCAAGAGGCAGGAGAATGG - Intergenic
1027210415 7:76142562-76142584 CCTGCCTTGGGGCAGGTGAAAGG - Intergenic
1032001045 7:128265483-128265505 CTTCCCAGCATCCAGGTGAAAGG + Intergenic
1033186097 7:139228213-139228235 CTTGCCGTGATGGAGGCCAAGGG - Intergenic
1037550457 8:19965918-19965940 TTTGTCATGATGCAGGCCAATGG - Exonic
1039211054 8:35215105-35215127 CTCGCCAAGTTGCAGGCGAAGGG - Intergenic
1039851880 8:41375111-41375133 CTGGGCATGAGGCAGGAGAATGG + Intergenic
1040560256 8:48517448-48517470 CTTGCCTGGCTGCAGGTGCAGGG + Intergenic
1041732028 8:61072042-61072064 CTTGCTTAGATGCGGGTGAATGG + Intronic
1041875237 8:62680020-62680042 ATTGGCAAGATGCAGTTGAAGGG + Intronic
1042148496 8:65757190-65757212 CCTGCCTTGGGGCAGGTGAAAGG + Intronic
1043737634 8:83768093-83768115 CTTGCCACATTGCAGGTGATGGG - Intergenic
1045517461 8:102872560-102872582 CCTGCCTTGGGGCAGGTGAAAGG + Intronic
1046197990 8:110888636-110888658 TCTGCCATGGGGCAGGTGAAAGG - Intergenic
1048990858 8:139759392-139759414 ATTGCCATGAGGAAGGTGAGAGG + Intronic
1049508471 8:143016030-143016052 CCTGCCTTGGGGCAGGTGAAAGG - Intergenic
1051317150 9:15851740-15851762 TTTGCCAGGATGTAGGGGAAAGG - Intronic
1051844560 9:21436918-21436940 CCAGCCATGATGGAGGTTAAGGG - Intronic
1055398018 9:75893378-75893400 CATGCCATGATGAAGGAGGAAGG + Intronic
1059244089 9:112834691-112834713 CCTGCCTTGGGGCAGGTGAAAGG + Intronic
1061024615 9:128040275-128040297 CCTGCCTTAAGGCAGGTGAAAGG - Intergenic
1062585833 9:137249542-137249564 CCTGCCTTGGGGCAGGTGAAAGG - Intergenic
1192698644 X:73445217-73445239 ATTGCAATAATACAGGTGAATGG - Intergenic
1192807784 X:74525085-74525107 ATTGCCAGGATGCAGGAGACTGG + Intronic
1194302699 X:92207374-92207396 ATTGCCATGAATCAGGGGAAGGG - Intronic
1195907058 X:109854499-109854521 ATTCCCAGGATGAAGGTGAAAGG + Intergenic
1199387308 X:147237803-147237825 CTTGCCATGGAGCAAGAGAAAGG + Intergenic
1199434224 X:147795100-147795122 CATGCCATGATTTTGGTGAAAGG + Intergenic
1199723124 X:150557514-150557536 CTTGCCTTGGAGCAGGTGAGAGG - Intergenic
1200805079 Y:7425209-7425231 CCTGGCATGATGCTGGTAAATGG - Intergenic
1200835206 Y:7725829-7725851 CATGCGATGGTGAAGGTGAAAGG - Intergenic
1201951187 Y:19566539-19566561 CTTGATATGATGGAGGCGAAGGG - Intergenic