ID: 903337793

View in Genome Browser
Species Human (GRCh38)
Location 1:22636576-22636598
Sequence CTGAAGAAGGGGAAGTAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 812
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 742}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903337787_903337793 3 Left 903337787 1:22636550-22636572 CCACTGGGGAAGTTCAGGGGGCA 0: 1
1: 0
2: 2
3: 15
4: 213
Right 903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG 0: 1
1: 0
2: 5
3: 64
4: 742
903337779_903337793 19 Left 903337779 1:22636534-22636556 CCTGGTGAGCTTCTGGCCACTGG 0: 1
1: 0
2: 0
3: 21
4: 233
Right 903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG 0: 1
1: 0
2: 5
3: 64
4: 742
903337778_903337793 20 Left 903337778 1:22636533-22636555 CCCTGGTGAGCTTCTGGCCACTG 0: 1
1: 0
2: 1
3: 11
4: 193
Right 903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG 0: 1
1: 0
2: 5
3: 64
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903337793 Original CRISPR CTGAAGAAGGGGAAGTAGGA AGG Exonic
900530195 1:3149281-3149303 CTGAAGAAGATGAAGCAGGCAGG + Intronic
900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG + Intronic
900968379 1:5975466-5975488 CTGAAGAAGGGAATGCAGCAAGG - Intronic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901410223 1:9077776-9077798 GGAAAGAAGGGGAAGAAGGAAGG + Intronic
901881053 1:12194049-12194071 CTGAACAAGTGGATGAAGGAAGG - Intronic
901909069 1:12439739-12439761 GGGAAGAAAGGGAAGAAGGAAGG + Intronic
901939704 1:12652585-12652607 CTCAAGAAAAGGAAGTGGGATGG + Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903036070 1:20493374-20493396 CAGAAGACGGGGAAGTGAGAAGG + Intergenic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903886322 1:26543041-26543063 CTGCAGAGGGGGAAGTGAGAAGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904663978 1:32105939-32105961 CTTAAGCAGGGGCAGTAGGAAGG + Intergenic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
904995412 1:34627706-34627728 GTGGGGAAGGGGAGGTAGGAAGG + Intergenic
905168019 1:36094516-36094538 CTGAAGAAGGGAAAATTGAAAGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905313572 1:37066870-37066892 ATGAAGATGGGGAAGGAGGGAGG - Intergenic
905939139 1:41848997-41849019 CTGAAGAATGGGAAGAAAGGAGG - Intronic
906448631 1:45924472-45924494 CAGAAGAGAGGGAACTAGGAGGG + Intronic
906976636 1:50581460-50581482 ATAAAGAAAGGGAAGAAGGAAGG - Intronic
907413479 1:54298343-54298365 CTGACGAGGGGGCAGCAGGAAGG + Intronic
907445653 1:54506217-54506239 ATGAAGAAGGGAAAGAAAGAGGG - Intergenic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909433984 1:75619107-75619129 AGGAAGAAGGGGAGGGAGGAAGG + Intergenic
909562980 1:77025781-77025803 CTGGAGGAGGGGCAGCAGGAGGG - Intronic
911468727 1:98288679-98288701 CTGAAGAAGAGGAAGTGATAAGG + Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911692568 1:100850923-100850945 CTGATGAGGGGGAAGCAGTAGGG + Intergenic
911694242 1:100870529-100870551 ATGAGGGAGGGGAAGAAGGAGGG + Intergenic
911718597 1:101165221-101165243 CTGCTGAAGGGTAAGTAGGAAGG + Intergenic
911924014 1:103803684-103803706 CTTAGGGAAGGGAAGTAGGAGGG - Intergenic
912928897 1:113938449-113938471 CGGGAGAAGGGGAAGCAAGATGG + Intronic
913010443 1:114677845-114677867 TTGAGGAAAGGGAAGAAGGAAGG - Intronic
913023765 1:114813782-114813804 CTCAAGAAGCTGAAGTAGGAGGG - Intergenic
913241008 1:116829331-116829353 CTGAAGAAGAGGAGGTACGTGGG - Intergenic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
913459567 1:119069924-119069946 CTGGAGAAGGGTATGTAGGCAGG + Intronic
914912465 1:151798959-151798981 CTAAAGAAGGGGAAGTTGCTGGG + Intergenic
915222429 1:154385659-154385681 CTGAAGAGGAGGAAGTAGAGAGG - Intergenic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
915952575 1:160199221-160199243 CTGAGCAAGGGGAAACAGGACGG + Intronic
916144875 1:161729441-161729463 ATGAATATGGGGAAGTAGGAAGG + Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917536292 1:175876974-175876996 CTGAAGATGGGGAGGTGGCAGGG - Intergenic
917726928 1:177837071-177837093 CTGAAGATGGGGAAAGAGGGAGG + Intergenic
917815521 1:178706124-178706146 CTGAAGGAGTGGAAGTTTGATGG + Intergenic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918336524 1:183520561-183520583 CTAAAGTAGGGGGAGTAGGAAGG + Intronic
918745767 1:188197064-188197086 CTGAAAAGGGGGAAGTAATATGG - Intergenic
919058864 1:192605997-192606019 AGGAAGAAAGGAAAGTAGGAAGG + Intergenic
919422976 1:197394156-197394178 CAGAGGAAGTGGAAGTAGAAGGG - Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920063269 1:203244069-203244091 AAGAAGAAGGGGAGGAAGGAGGG + Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920162720 1:204011654-204011676 CTGAGGCAGGGGGAGCAGGAGGG + Intergenic
920596841 1:207280240-207280262 CTGAAGAAGGGGATGAAGGAGGG + Intergenic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921354926 1:214276912-214276934 CTGAACAAAGTGCAGTAGGAAGG - Intergenic
922065336 1:222132912-222132934 CTAAAGAAAGGCAAGAAGGAAGG + Intergenic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
922723323 1:227909896-227909918 AGGAAGAAGGGGAGGAAGGAGGG + Intergenic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
924052152 1:240090166-240090188 CAAAAGAAGGGAAAGAAGGAGGG - Intronic
924064908 1:240210998-240211020 AGGAAGAAGGGGAGGGAGGAAGG - Intronic
1063096573 10:2913638-2913660 CTGAGGAAGGCAGAGTAGGAAGG + Intergenic
1063245747 10:4216454-4216476 CTTAGGAAGGGGAAGAAGGATGG + Intergenic
1063511268 10:6647220-6647242 CAGAGGAAGGGAAAGAAGGAAGG - Intergenic
1063953956 10:11248448-11248470 CTGAAGAATGGAAGGAAGGATGG - Intronic
1063965243 10:11341332-11341354 CTGAACAAGGTGAACTAGGTAGG - Intergenic
1064330531 10:14389924-14389946 CTGAAGAAGTGGTAGTTGGTAGG - Intronic
1064630767 10:17308571-17308593 CTGAATAAGGTGAAGTACCAAGG + Intergenic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1064688354 10:17887504-17887526 CTGAAGAAGCGAAAGTAGAATGG + Intronic
1065404533 10:25349271-25349293 CTCATGAAGGGAAGGTAGGAGGG - Intronic
1065412977 10:25450721-25450743 TCAAAGAAGGGGAAGAAGGAAGG - Intronic
1066265759 10:33774385-33774407 CTGCAGATGGGGAAGCCGGAAGG - Intergenic
1067707515 10:48620898-48620920 CTGAGGAAGGTGAAGCAGCAAGG - Intronic
1067991526 10:51218866-51218888 GAGAAGAAGGGGAGGAAGGAAGG + Intronic
1068182590 10:53541335-53541357 CTGAGGAAGGGGAAATAACAAGG + Intergenic
1068316671 10:55353107-55353129 TTGAAGAAGTGGTAGTCGGATGG - Intronic
1068775265 10:60862083-60862105 AGGAAGAAGGGAAAGAAGGAAGG - Intergenic
1069200793 10:65613276-65613298 CTGAACAAGGGGAAGTTTGCAGG - Intergenic
1069230960 10:66007854-66007876 AGGAAGGAGGGGAAGTAGGAAGG - Intronic
1069509821 10:69033803-69033825 ATGAAGAAAGGGAAGTTTGAAGG - Intergenic
1069603947 10:69728309-69728331 TGGAGGAAGGGGAAGCAGGAAGG - Intergenic
1069726952 10:70586254-70586276 CTGAAGATGAGGAGGTGGGAGGG + Intergenic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070360171 10:75680664-75680686 ACGAGGAAGGGGAAGTAGGTAGG + Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070704370 10:78627050-78627072 CTGTAGACAGGGAAGTAGGCAGG - Intergenic
1070888592 10:79925750-79925772 AGGAAGAAAGGGAAGGAGGAAGG - Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072479623 10:95798075-95798097 GCAAAGTAGGGGAAGTAGGATGG + Intronic
1073024920 10:100480867-100480889 ATAAAGATGGGGAAATAGGATGG + Intronic
1073479922 10:103779937-103779959 CTGAAGAAGGGGGAAGGGGAAGG + Intronic
1073481154 10:103786904-103786926 CTCAGGAAGGGCAAGAAGGAAGG - Intronic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074085846 10:110208631-110208653 AGGAAAAAGGCGAAGTAGGAGGG - Intronic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075565464 10:123500481-123500503 CAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1076637829 10:131893919-131893941 CTGAAGGAAGGGAAGAAAGATGG - Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1077080200 11:721652-721674 CGGAAAAAGGGGAAGAAGAAGGG + Exonic
1077391342 11:2301968-2301990 CGGAAGAAGGGCAGGCAGGAAGG - Intronic
1077876484 11:6312753-6312775 CTGAGGAAGGGTATGAAGGAGGG + Intergenic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078156632 11:8805556-8805578 CTGAAGGACTGGAAGTAGGAGGG - Intronic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1079151312 11:17902130-17902152 CTGAAGAAGGGAGAGAGGGATGG + Intronic
1081132671 11:39399682-39399704 CTGATGATGGGGAGGTAAGAGGG + Intergenic
1081224421 11:40502397-40502419 CTGGAGACGGGGAAGAAGAAAGG + Intronic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1082013884 11:47469898-47469920 GAGAAGAAGGGGATGTGGGAAGG + Intronic
1083068660 11:59952630-59952652 CAGAAGAGGGGGAAGTTGGGAGG + Intergenic
1083168260 11:60905415-60905437 CCAAAGAGGGGGAAGAAGGAAGG - Intronic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083886763 11:65576872-65576894 CTGAAGAGGCGGGAGTTGGAGGG - Intronic
1084160585 11:67347264-67347286 CTGAACAAAGGCAAGCAGGAGGG - Intronic
1084953577 11:72679736-72679758 ATGAAGAGGGGGAAGTAGTCCGG - Intergenic
1085325592 11:75604098-75604120 GTGAGGAAGGAGAAGTATGAAGG - Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1085988966 11:81816929-81816951 AGGAAGAAGGGGAGGAAGGAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087569850 11:99912118-99912140 CTGAAGAATGTCAAGAAGGAAGG + Intronic
1088245260 11:107812228-107812250 ATGAAGAATGGAAACTAGGAGGG - Intronic
1088381272 11:109195093-109195115 ATGAAGGAAGGGAAGAAGGAAGG - Intergenic
1088489119 11:110369912-110369934 ATGAAGAGAGGGAAATAGGAAGG - Intergenic
1088648381 11:111936695-111936717 CTAAAGAAGAGGAAGCAGAAGGG - Intronic
1089078747 11:115759683-115759705 CTGGAGAAGGGGACGCAGGGAGG - Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089240220 11:117071572-117071594 AGGAAGAAGGGGAAGAAGAAGGG + Intronic
1089407081 11:118206694-118206716 CAGAAGCAGGGGAAGTCGGGAGG - Intronic
1089459037 11:118642058-118642080 AGGAAGAAGGGGAGGAAGGAAGG - Intronic
1089755514 11:120683364-120683386 ATTAAGAAGGGGAAGAAGGGAGG + Intronic
1090475080 11:127013021-127013043 CGGAAGAAAGGGAGGAAGGAGGG + Intergenic
1090593723 11:128298100-128298122 CTGAAAAAGGGCAAATGGGAAGG + Intergenic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1091131243 11:133148851-133148873 CTGAAAAAGGGAAGGAAGGAAGG + Intronic
1091252341 11:134154423-134154445 CTGAGGAAGAGGACGCAGGAGGG - Intronic
1091375277 12:21060-21082 CTCAAGAAGGGTAATGAGGATGG + Intergenic
1091730364 12:2876506-2876528 CTGCAAAAGGGTAAGTAAGATGG + Intronic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092518391 12:9240152-9240174 ATGAAGAAGAGGAAGAAGGTGGG - Intergenic
1092712343 12:11352533-11352555 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092716079 12:11392253-11392275 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092727326 12:11498902-11498924 CTGAAGAATGGGAAATGGAAAGG + Intronic
1092796091 12:12111320-12111342 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
1092955873 12:13549303-13549325 CTGAAGAAAGGGAAGCATGGGGG - Exonic
1093150710 12:15617858-15617880 CTCAAAAAGAGAAAGTAGGAGGG + Intergenic
1093913360 12:24772521-24772543 ATGAAGAAAGGAAAGAAGGAAGG + Intergenic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094801680 12:34044769-34044791 CTCATGAAAGTGAAGTAGGAAGG - Intergenic
1095114813 12:38340675-38340697 CTCAGGAAAGTGAAGTAGGAAGG - Intergenic
1095199592 12:39367165-39367187 CTGAAAAAGGGGAAGAAACAAGG + Intronic
1095271955 12:40229100-40229122 CTTAACAAGGGGATGTAGAAAGG + Intronic
1095929111 12:47608012-47608034 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096096743 12:48940477-48940499 GTGAAGAAAGGGAAGTAAGCTGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096447460 12:51706471-51706493 AGGAAGAAGGTGAAGAAGGAGGG + Exonic
1096913743 12:55010099-55010121 GTGAAGGAGGGGAAGTAAAAAGG - Intergenic
1096972580 12:55679705-55679727 CTGAAGATGGGGATGAAAGAGGG + Intergenic
1097119577 12:56721040-56721062 CTGAAGGAGGTGAAGTAAGAAGG + Exonic
1097161071 12:57047139-57047161 CTAGAGAAGGGAAAGGAGGAAGG + Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097969005 12:65612173-65612195 TTCAAGAAGGGAAATTAGGATGG - Intergenic
1098040776 12:66352301-66352323 CTGAAGTAGAGGAAGGAGCAGGG + Intronic
1098152153 12:67557830-67557852 CTGAGGAATGGGAAATAGGAAGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099860019 12:88214752-88214774 CTGAAGGAGGGAAGGAAGGAAGG + Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100121918 12:91378482-91378504 CAGAATAAGGGGAAGTTTGAGGG - Intergenic
1100197280 12:92261184-92261206 CTGATGTAGGACAAGTAGGACGG - Intergenic
1100199820 12:92286386-92286408 CCTAAGAAGGGGATGTAAGAAGG + Intergenic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102544196 12:113642762-113642784 AGGAAGAAGGGAAAGAAGGAAGG - Intergenic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102656660 12:114487690-114487712 CTGAAGAAGAAGATGTAGAATGG + Intergenic
1102887578 12:116533558-116533580 ATGAAGAAGGGGGACAAGGAGGG - Intergenic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103782405 12:123407725-123407747 TTGAAGAAGGGAAAGTGGGGCGG - Exonic
1103981635 12:124740738-124740760 CTGAGGGAGGGCATGTAGGAGGG - Intergenic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1105217691 13:18298755-18298777 TTGAAGAAGGGAAAGTGGGGCGG - Intergenic
1105775469 13:23655457-23655479 CTGAAGAAGTGGAAATAGGAAGG - Intronic
1107098253 13:36559985-36560007 TTGGAGAAGGGGAGGTAAGAGGG + Intergenic
1107222139 13:37995571-37995593 CTGATGAGGGTGAAGTAGAAGGG - Intergenic
1107606197 13:42059686-42059708 CTGAAGAAGGGCAGATAAGAAGG - Intronic
1108297717 13:49041464-49041486 CTGAAGAGTGGGGACTAGGAAGG - Intronic
1109239557 13:59868718-59868740 CTGAGGAGAGGGAAGAAGGAAGG - Intronic
1109299921 13:60580340-60580362 CTAAAGATGGGGAGGTAGGGAGG + Intergenic
1109512314 13:63394331-63394353 AGGAAGAAGGGGATGGAGGAAGG + Intergenic
1110282425 13:73710701-73710723 CTCAAGAAGAGGGAGTAAGATGG - Intronic
1110476708 13:75923838-75923860 CTGAAGATGGGGGAGAATGAAGG + Intergenic
1110965531 13:81690225-81690247 ATGAAGAAGAGGAAGAAGGTGGG + Intergenic
1111127840 13:83935342-83935364 CTGAAGAAGGGCATGGAGGAAGG + Intergenic
1111255469 13:85661922-85661944 CTGAAGGAGCTGAAGTTGGAAGG - Intergenic
1111546724 13:89747693-89747715 CTGAAAAAGGGTAAGTGTGATGG + Intergenic
1111613868 13:90640060-90640082 ATGAAGAAAGGAAAGAAGGAAGG - Intergenic
1111633249 13:90870481-90870503 CAGAAGAAGGGGAAGGACAAGGG - Intergenic
1112953515 13:105031716-105031738 CTGAAGCAGAGGAAGTTAGATGG + Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1115939231 14:38589976-38589998 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939238 14:38590001-38590023 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939245 14:38590026-38590048 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939252 14:38590051-38590073 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939259 14:38590076-38590098 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939266 14:38590101-38590123 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115983329 14:39077645-39077667 GTGAGGAAGGGGAAGTAGATTGG - Intronic
1116133301 14:40889185-40889207 AGGAAGGAGGGGAAGAAGGAGGG + Intergenic
1116500276 14:45612551-45612573 ATGAAGATTGGAAAGTAGGAAGG + Intergenic
1116752882 14:48909102-48909124 CTGAAGGAGGGGAAGAAAGAAGG - Intergenic
1117351243 14:54883881-54883903 CTAAAGAAGGTGAGGCAGGAAGG + Intronic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1117987028 14:61396778-61396800 CTGAAGATTGGGGAGTGGGATGG + Intronic
1118656237 14:67952682-67952704 CGGAAGTAGGAGTAGTAGGAGGG + Intronic
1119068887 14:71560447-71560469 AGGAAGAAGGGGGAGTAAGAAGG + Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119597263 14:75946840-75946862 CTGAAGAAGGGGGAATAAGCTGG + Intronic
1119642250 14:76324132-76324154 CTGAAGAAGGAAAAATAGGGCGG + Intronic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1119890196 14:78176814-78176836 CTGAAGAAAGAGAACTAAGAAGG - Intergenic
1121103464 14:91265100-91265122 CTGGAGAAGGGCAAGGAGGGAGG + Intergenic
1121325432 14:93016920-93016942 CTGGAGATGGGGCAGGAGGAGGG + Intronic
1121712189 14:96046750-96046772 CTTTAGAAGGGGAATTAGCAGGG - Intronic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1122002166 14:98667322-98667344 GGGAAGAAGGGAAAGAAGGAGGG - Intergenic
1122389947 14:101373381-101373403 CAGCAGAAAGGGAAGTTGGAGGG - Intergenic
1122500062 14:102191421-102191443 CAGAAGAGGAGGAAATAGGATGG + Intronic
1122863076 14:104591297-104591319 CTGAAGGAGGGGCAGGAGGCAGG - Intronic
1122873080 14:104650449-104650471 CTGACGACGGGGGAGGAGGAGGG - Intergenic
1123409967 15:20050051-20050073 TATAAGAAGGGGAAGCAGGAGGG + Intergenic
1123519299 15:21056758-21056780 TATAAGAAGGGGAAGCAGGAGGG + Intergenic
1123580727 15:21712969-21712991 TATAAGAAGGGGAAGCAGGAGGG - Intergenic
1123617376 15:22155592-22155614 TATAAGAAGGGGAAGCAGGAGGG - Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124018344 15:25897710-25897732 CTGTAGAAAGGAAAGTAGGGTGG - Intergenic
1124330023 15:28803486-28803508 CTGAAGAAGAGGAGGAAGGAGGG + Intergenic
1124548146 15:30651916-30651938 GGGAAGAAGGGGAGGGAGGAAGG - Intronic
1124614882 15:31234312-31234334 CTGAGGAAGGGGCAGAAGGGTGG + Intergenic
1125559295 15:40614527-40614549 CTGAAGAAGAGGGAATAGGCTGG - Intronic
1125778573 15:42242361-42242383 ATGAAGAAGCTGAAGTAGGGTGG + Intronic
1125929300 15:43589127-43589149 CTGGAGAAGGGGTAGAAGGGAGG + Intronic
1125942467 15:43688959-43688981 CTGGAGAAGGGGTAGAAGGGAGG + Intergenic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1126870577 15:52982716-52982738 AGGAAGAAGGGGAAAAAGGAAGG - Intergenic
1127471694 15:59295955-59295977 CTAAAGAGGGGGCAGGAGGAGGG + Intronic
1128220947 15:65968170-65968192 CAGAAGGAGGAGAAGTAGAATGG + Intronic
1128389252 15:67172203-67172225 CCGAGGAAGGGGCAGTAGGGAGG - Intronic
1128457611 15:67841087-67841109 TTGAAGGAATGGAAGTAGGAAGG - Intergenic
1129230410 15:74194084-74194106 CTCGAGAAGGGGAAGTGGGCAGG - Intronic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1129602981 15:77011020-77011042 GTGAAGGAGGGGAAGCAGGCGGG + Intronic
1130175942 15:81570919-81570941 CTGAAGAATGGGTTGCAGGAGGG - Intergenic
1130987551 15:88854661-88854683 ATGAAGAAAGGAAAGAAGGAAGG - Intronic
1131059923 15:89398308-89398330 CTGGAGAAGCGTAAGTAGGAGGG + Intergenic
1131225727 15:90623244-90623266 CTGATGATGGGTAAGCAGGAAGG - Intronic
1132303052 15:100788263-100788285 CTGCTGCAGGGGAAGTAGCAGGG - Intergenic
1202989597 15_KI270727v1_random:447214-447236 TATAAGAAGGGGAAGCAGGAGGG - Intergenic
1133275996 16:4638823-4638845 CCGAGGAAGGGGGAGTGGGAAGG - Intronic
1133890884 16:9877677-9877699 CTGAAGAGGGGGAAGAGAGAGGG - Intronic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1133937009 16:10277624-10277646 AAGAAGAGGGGGAAGTAGGAGGG - Intergenic
1134069658 16:11253173-11253195 CTTAATAAGGTGAAGTGGGAGGG - Intronic
1134562012 16:15219039-15219061 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1134922550 16:18130665-18130687 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1135976020 16:27109439-27109461 AGGAAGGAGGGGAAGTTGGAGGG + Intergenic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137557024 16:49477227-49477249 GAGAAGGAGGGGAAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137715655 16:50596839-50596861 CTGAAGGAGGGGCAGGAGGGAGG + Intronic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1138517179 16:57542620-57542642 AGGAAGAAGGGGAAGTCGGGAGG - Intronic
1139060940 16:63250684-63250706 AAGAAGAAGGGGAAGGCGGAGGG + Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1139478658 16:67216142-67216164 CTGAAGAAGGAGCAGTGGAAAGG - Intronic
1140025480 16:71286465-71286487 CTGAAGGAGGTAAAGTATGACGG - Intronic
1140980112 16:80100419-80100441 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1141248307 16:82331555-82331577 ATGAAGAAGAGGAAGTGGGTTGG + Intergenic
1141527101 16:84618430-84618452 GGGAAGAAGAGGAAGGAGGAGGG - Intergenic
1141793793 16:86255259-86255281 CTTAAGAAGGGAAAGAAGAATGG - Intergenic
1141803878 16:86329820-86329842 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1142204740 16:88777568-88777590 CTGAGGCAGGGGCAGTGGGATGG + Intronic
1142968353 17:3594914-3594936 CTGAAGAACGGGAAGTCAGTGGG + Intronic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1143871312 17:9959018-9959040 CAGGAGAAGGGGAGGTGGGAGGG + Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144526813 17:15997607-15997629 CTGAAGAATGGGGGTTAGGAAGG + Intronic
1144721153 17:17470726-17470748 TTAAAGAAGGGAAAGGAGGAGGG + Intergenic
1145881034 17:28352880-28352902 CTCAAGAAGGGGAGGTGGAATGG - Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1148384259 17:47222900-47222922 CTGGAGAAAGGGGAGCAGGAGGG + Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148641382 17:49190310-49190332 AGGGAGAAGTGGAAGTAGGAAGG + Intergenic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149045846 17:52244475-52244497 CTGGAGGAGAGGAATTAGGACGG - Intergenic
1150416919 17:64995439-64995461 CTGAGGAAGGGACAGAAGGATGG + Intergenic
1150490201 17:65569052-65569074 CTGAAGAAGTGGCAGAGGGAGGG - Intronic
1150605573 17:66687781-66687803 GTAGAGAAGGGGAAGAAGGAAGG + Intronic
1150767772 17:68015762-68015784 CTAAAGGAGGGGAAGGAGGTGGG + Intergenic
1151282785 17:73089086-73089108 CAGAAGAAGGGGGCATAGGAGGG + Intronic
1151392261 17:73795415-73795437 CTGAAGAATGGGAAATGGAAGGG + Intergenic
1151493571 17:74446555-74446577 CTAAACAATTGGAAGTAGGAGGG + Intronic
1151890431 17:76948043-76948065 TTCAGGAAGGGGAAGAAGGAGGG - Exonic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152893460 17:82896090-82896112 CTGAAGAAGGGGGTGTGGGAGGG - Intronic
1153269323 18:3304054-3304076 ACTCAGAAGGGGAAGTAGGAGGG + Intergenic
1153442935 18:5140908-5140930 CTGAAGAAAGGAAAGTATGAGGG - Intergenic
1154957842 18:21276757-21276779 AGGAAGAAAGGGAAGAAGGAAGG + Intronic
1155503151 18:26506685-26506707 CTGGAGAAGAGGAGGTAGAAAGG + Intronic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156389283 18:36635526-36635548 CTGAAGCAGGGGAAGAGAGAAGG + Intronic
1156511337 18:37639465-37639487 AGGAAGAAGAGGAAGAAGGAAGG - Intergenic
1156764342 18:40633113-40633135 ATGAAGAAAGGAAAGAAGGAAGG + Intergenic
1156876466 18:42019913-42019935 CTGGTGGAGAGGAAGTAGGAAGG - Intronic
1157404455 18:47411329-47411351 CTGGAGGAGGTGAAGTGGGAAGG + Intergenic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1159325968 18:66918308-66918330 GTGAAGAAAGGGAGGAAGGAAGG - Intergenic
1159999540 18:75003503-75003525 GGGAAGAAGGGGAAGAAAGAAGG - Intronic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1161403993 19:4081770-4081792 GAGGAGAAGGGGGAGTAGGAGGG - Intergenic
1161713211 19:5861631-5861653 CTGAAGAACGGGAACTAGGCAGG - Intergenic
1161847704 19:6721081-6721103 CTGAGGGAGGGGAAGTAGAATGG + Intronic
1162857055 19:13476846-13476868 CAGAAGCTGGGGAATTAGGAAGG - Intronic
1163779546 19:19239370-19239392 GGGAAGATGGGGAGGTAGGAGGG - Intronic
1163931564 19:20398363-20398385 GTGAAGAAGGGGTTGTGGGATGG + Intergenic
1163965335 19:20741455-20741477 CTGAAGAAGGAGAAATAACATGG - Intronic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1164744938 19:30604894-30604916 CTGGAGAAGGGACAGCAGGAAGG + Intronic
1164839249 19:31380271-31380293 CTGCGGGAGGGGAGGTAGGAAGG + Intergenic
1165361669 19:35340802-35340824 CGGGAGAAGAGGAAGCAGGAGGG + Intronic
1165569186 19:36761128-36761150 CTGAAGAGGTGGAAGTAAAAGGG + Intronic
1165847392 19:38827054-38827076 GGGAAGGAGGGGAAGGAGGAAGG + Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167244589 19:48365528-48365550 CAGAAGTCGGGGACGTAGGATGG - Intronic
1167579084 19:50331530-50331552 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167579096 19:50331570-50331592 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167579108 19:50331610-50331632 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168328790 19:55554000-55554022 AGGAAGAAAGGGAAGAAGGAAGG - Intergenic
925034257 2:673775-673797 AGGAAGGAGGGGAAGGAGGAGGG + Intronic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
925554158 2:5110895-5110917 CTGAAGTAGGGGAGAGAGGAGGG + Intergenic
926011959 2:9415651-9415673 CTGAGGAAGTGGCAGTAGGGAGG + Intronic
926244574 2:11113502-11113524 AGGAAGAAGGGGAGGGAGGAAGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926931100 2:18041814-18041836 CTGAAGTAGGGCAAGTAACATGG + Intronic
927091957 2:19719151-19719173 CTGGAGAGGGGGAACCAGGAAGG - Intergenic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927629605 2:24761195-24761217 CTGAAGGAGAGGAATAAGGATGG - Intronic
928781949 2:34833876-34833898 GTGGAGAAGGGGAAGAAGAAGGG + Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929937441 2:46303866-46303888 GTGAAGAATGGGGAGGAGGAAGG + Intronic
931394063 2:61870403-61870425 CGGGATAAAGGGAAGTAGGATGG - Intronic
931701495 2:64912982-64913004 CCCAAGAAGGGCATGTAGGATGG - Intergenic
931711063 2:64989350-64989372 ACGCAGACGGGGAAGTAGGAGGG - Intronic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
932383871 2:71312682-71312704 CTGAAGAGGAGGAAGAAGAAAGG + Intronic
932800927 2:74741759-74741781 ATGAAGAAGTGGAAGCAGCAAGG - Intergenic
932860417 2:75285841-75285863 TTGAAAAAGTGGAAGTGGGAAGG - Intergenic
933030846 2:77326818-77326840 CAGAGGAAGGGAAAGTAGGCTGG - Intronic
933725136 2:85422528-85422550 CTGGGGATGGGGAGGTAGGAGGG + Intronic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933896243 2:86812357-86812379 GTGAGGAAGGGAAAGTAGTATGG + Intergenic
934296617 2:91747896-91747918 TTGAAGAAGGGAAAGTGGGGCGG + Intergenic
934571102 2:95373970-95373992 CTGAACAAGGGGATATAGGAGGG - Intronic
934903085 2:98176465-98176487 CCGAAGAAGGGAAGGAAGGAAGG - Intronic
935082998 2:99817000-99817022 CTAGAGAAGGGGAAGAAGAATGG - Intronic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936068328 2:109348738-109348760 AGGAGGAAGGGGAAGCAGGAGGG - Intronic
936993009 2:118386104-118386126 ATGAAGAGAGGGAGGTAGGAAGG + Intergenic
937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG + Intergenic
937352179 2:121173111-121173133 CAGAAGTACGGGAAGTAAGAGGG + Intergenic
937419258 2:121740847-121740869 AGGAAGAAAGGGAAGGAGGAAGG - Intronic
938120347 2:128628601-128628623 CCGAAGAAAGGGAGGGAGGAAGG - Intergenic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
939059335 2:137400849-137400871 CTGGAGCAGGGGAAGAAGGTAGG + Intronic
939202992 2:139062665-139062687 CTGAAGAAGGGGAAGTCTTCTGG - Intergenic
939667901 2:144973140-144973162 TTAAAGAAAGGAAAGTAGGATGG - Intergenic
940394000 2:153166560-153166582 CTTAAGAATGGGAAGCAGCATGG - Intergenic
940444821 2:153765089-153765111 GTGCAGAAGGGAAAGTGGGATGG + Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941234021 2:162946623-162946645 GGGAAGAAGGGGAAGGAGAAGGG + Intergenic
941293080 2:163700372-163700394 TTGAAGAAGAGAAAGAAGGAAGG + Intronic
941339345 2:164287108-164287130 TAGAAGAAAGGGAAGAAGGAAGG + Intergenic
941391825 2:164924325-164924347 CTAAAGAATGGAAAGAAGGAGGG + Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942183338 2:173401720-173401742 AAGAAGAAGGGAAAGAAGGAAGG - Intergenic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942647879 2:178134220-178134242 CTGCAGAAGTGGCAGAAGGAAGG + Intronic
943271969 2:185817012-185817034 GTGAAGAAAGGGAAGGAGCAAGG + Intronic
943400366 2:187401982-187402004 AGGAAGAAGGGAAAGAAGGAAGG + Intronic
943876307 2:193071915-193071937 CAGAAGAAGGGAAAGGCGGAAGG - Intergenic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
944320293 2:198332547-198332569 CATAAGAAGGGGAGGTGGGATGG + Intronic
944885930 2:204062764-204062786 AGGAAGAAAGGGAAGAAGGAAGG - Intergenic
945014028 2:205495732-205495754 ATGAAGGAAGGGAAGTAGGTTGG + Intronic
945155842 2:206836293-206836315 GTGCAGAAGGGAAAGAAGGAAGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945534509 2:210997712-210997734 CAGGAATAGGGGAAGTAGGAGGG + Intergenic
945656287 2:212628012-212628034 ATGACCTAGGGGAAGTAGGAAGG + Intergenic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946842726 2:223834647-223834669 CTCAAGAAGCTGAGGTAGGAGGG + Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947874094 2:233457234-233457256 CTGAAGACTGGGGAGTGGGATGG - Exonic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169022476 20:2340242-2340264 CTTCAGCAGGGGAAGCAGGAGGG - Intronic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169063950 20:2682173-2682195 GAGAAGAAGGGGAAGAAGAAGGG + Intergenic
1169598912 20:7234381-7234403 AGGAAGAAGGAGATGTAGGAAGG - Intergenic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1170096324 20:12649622-12649644 ATGAAGAAAGGAAAGGAGGAGGG + Intergenic
1170126610 20:12970759-12970781 CTGAGGAAGGGGAGAAAGGATGG - Intergenic
1170360426 20:15540191-15540213 TTGAATGTGGGGAAGTAGGATGG + Intronic
1170623368 20:18012110-18012132 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
1170881002 20:20296347-20296369 ATGAAGAAAGGAAAGAAGGAAGG - Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172485208 20:35293806-35293828 CTGGAGGAGGGGAAGAAGGCTGG - Intergenic
1172870480 20:38132501-38132523 CTGCAGAAGGGGAGAAAGGAGGG + Intronic
1173608695 20:44350920-44350942 TTTAAGAAGGGGATCTAGGAGGG - Exonic
1174067158 20:47873815-47873837 CTGAAGAAGTGGAACCAGCAGGG + Intergenic
1174198432 20:48789931-48789953 GTGAAGAAGGGGAGGAAAGAAGG + Intronic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174835392 20:53852073-53852095 AGGAAGAAGGGGAAAAAGGACGG - Intergenic
1175096934 20:56548676-56548698 GTAAAGAAGGGGAAGGAGGATGG - Intergenic
1175221163 20:57417320-57417342 CTGAAGAAAGGGAAAAAGAATGG + Intergenic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176902854 21:14464512-14464534 CTGAAGAAGAGGCAGTGGGGAGG + Intergenic
1177114863 21:17073343-17073365 AAGAAGAAGGGGAAGGAGAAGGG + Intergenic
1178270608 21:31186215-31186237 CTAAAGAAGGGGAGGGAGGCTGG + Intronic
1178872607 21:36388859-36388881 CTGAAGAGGGGCCAGTGGGAGGG - Intronic
1178972753 21:37195386-37195408 CTGAAGGAGGGCCAGTAGGCAGG + Intronic
1179483242 21:41691893-41691915 CTGAAGAAGAGGATGGATGAGGG + Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1182026553 22:27123707-27123729 CTGAAGAAAGGGAGGCAGAAAGG + Intergenic
1182843469 22:33411036-33411058 CAGTAGAAGGGAAAGAAGGAAGG - Intronic
1183628693 22:39020536-39020558 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183632172 22:39040295-39040317 GGGAAGAAGGAGAAGCAGGAAGG + Intergenic
1183637993 22:39076696-39076718 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183866738 22:40710288-40710310 CTTAAGAAGCAGTAGTAGGACGG - Intergenic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184726521 22:46350545-46350567 CTGGAGAAGGGGAAGTGGTGCGG - Intronic
1184786023 22:46672388-46672410 TTGAAGAAGGGCAGGTGGGAGGG + Intronic
1185305495 22:50113124-50113146 TAGAAGAAGGGGAAGTAAGTGGG + Intronic
949977800 3:9476809-9476831 CTTGGGAAGGGGGAGTAGGATGG - Exonic
950174167 3:10860730-10860752 TTGAAGAGGGGGAAGCAGGGAGG + Intronic
950539323 3:13600555-13600577 CTGGAGAAGGGAGAGTAAGAGGG + Intronic
950688973 3:14640625-14640647 CTGAGGGAGGGGGACTAGGAGGG + Intergenic
951140720 3:19155426-19155448 CTGAACAAGTGGGAGTAGAAGGG - Intronic
952766349 3:36957297-36957319 ATAATGAAGGGGAAGAAGGAAGG - Intergenic
953150556 3:40320435-40320457 CTGGAGTAGGGGAAGAAGAAGGG + Intergenic
954428700 3:50457814-50457836 CTGAAGCTGAGGGAGTAGGAGGG - Intronic
954654184 3:52183958-52183980 CACAAGAAGGGGAAGAGGGAGGG + Intergenic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955726782 3:61941713-61941735 CAAAAAAAGGGGAAGTTGGAGGG - Intronic
955889171 3:63632129-63632151 TGGAAGAAAGGGAAGAAGGAAGG + Intergenic
955889200 3:63632230-63632252 TGGAAGAAAGGGAAGAAGGAAGG + Intergenic
955889248 3:63632389-63632411 AGGAAGAAAGGGAAGAAGGAAGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957955931 3:87187010-87187032 ATGAAGCTGGGGAAGTAGGCAGG + Intergenic
960846209 3:122006546-122006568 CTGAAGAAGGGAATATAGCAAGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
961937912 3:130605014-130605036 GAGAAGAAAGGGAAGTAGCAGGG - Intronic
962086631 3:132198351-132198373 CTTCAGTAGGGGAAGTGGGAAGG - Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962389928 3:134962792-134962814 ATGAAGAGGGGGCAGGAGGAGGG - Intronic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
963534704 3:146513157-146513179 GTGAGGAAGGGGGAGAAGGAGGG - Intergenic
964579468 3:158216775-158216797 AGGAAGAAGGGAAAGTAAGAAGG - Intronic
964873042 3:161334407-161334429 CTAAAGAAGGGAAGGAAGGAGGG - Intergenic
965190622 3:165523556-165523578 CTCAAGAAGGAGAAGTCAGAGGG - Intergenic
965355452 3:167667382-167667404 AAGAAGGAGGGGAAGAAGGAAGG + Intergenic
965423305 3:168489783-168489805 CTGAAAAGTGGGGAGTAGGAAGG - Intergenic
965449253 3:168817315-168817337 CTGATTAAGAGGCAGTAGGAAGG + Intergenic
965539320 3:169856595-169856617 TTAAAGAAGGGTATGTAGGAGGG - Intronic
965702151 3:171468823-171468845 CTGAAGAAGAGCATGTGGGATGG + Intergenic
965907815 3:173731291-173731313 CTGAAGAATGGAAAGAAAGATGG + Intronic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967096981 3:186185432-186185454 TTGAAGAAGGGGAAGATGTAAGG + Intronic
967214429 3:187198583-187198605 CTGAACCAGGGCAAGCAGGAAGG - Intronic
967370877 3:188744700-188744722 CTGAAGAGGGGAAAGGAGGTTGG - Intronic
967420368 3:189265707-189265729 CAGAAGGAGGGGGAGTAGGAAGG - Intronic
967687248 3:192432075-192432097 TTGAAGAATGGGAATTAAGAGGG - Intronic
969253105 4:5982866-5982888 ATGAAGAAGGTGAAGAATGAGGG + Intronic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
970200274 4:13597711-13597733 CTGAAGAAGTGAAAATAGAAGGG - Intronic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971305164 4:25473421-25473443 GGGAAGAAGGGGAAGAAGAAAGG + Intergenic
971501805 4:27326294-27326316 CTCAAGAGGGGGAAGGAGGGAGG + Intergenic
972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG + Intergenic
972422838 4:38905792-38905814 CTGATGAAGGGGAAGTGGGTGGG - Exonic
972433406 4:39006833-39006855 CTACAGAGGGTGAAGTAGGAGGG + Intronic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
972730506 4:41789999-41790021 CTTAAGGAGGAGAAGAAGGAAGG - Intergenic
973059000 4:45695798-45695820 CTGAAGAAGTGGTAGTTGGTAGG - Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976858079 4:89628474-89628496 ATGAAGAGGGAGAGGTAGGAAGG - Intergenic
976888865 4:90020466-90020488 CAGAAGAAGAGGGATTAGGAAGG - Intergenic
977609874 4:99020613-99020635 CTGAAGCAAGGGATGGAGGAGGG - Intronic
977805155 4:101288592-101288614 GGGAAGGAGGGGAAGGAGGAAGG + Intronic
978483745 4:109226221-109226243 CAGAAGAATGGGAGGTAGGAGGG + Intronic
978718782 4:111879217-111879239 CTGAAGAAAGGAAGGAAGGAAGG - Intergenic
979267471 4:118720113-118720135 TTGAAGAAGGGGAGGCAGAATGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981614192 4:146629481-146629503 AGGAAGAAGGGGAATAAGGAAGG + Intergenic
981674533 4:147325883-147325905 ATGAAGGAAGGGAAGTAAGATGG + Intergenic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
982057081 4:151562273-151562295 ATGAAGAAGGAGGGGTAGGAAGG + Intronic
982289493 4:153765528-153765550 CTGAAGTATGGGAATTATGAGGG - Intergenic
982787749 4:159556182-159556204 ATGAAGGAGGGAAAGAAGGAAGG - Intergenic
983595852 4:169466999-169467021 CTGAAGAGGAGGAAGTTGGGGGG - Intronic
983599202 4:169505316-169505338 CTGAGGAAGGAGGAGTAAGAGGG - Intronic
983611794 4:169654238-169654260 AGGAAGAAGGGAAAGGAGGAGGG - Intronic
983648082 4:170011989-170012011 CAGAGGAGGGGGAAGTAGGTTGG + Intronic
983989410 4:174099330-174099352 CTGAAGGGGGGAAAGTAGGATGG + Intergenic
984873709 4:184349459-184349481 CGCAGGAAGGGGAACTAGGAAGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986678254 5:10208648-10208670 CTGAAGAAGAGGAAGAGGGAGGG - Intergenic
986746585 5:10750243-10750265 CTGATGAACGGGAAGGAGAATGG + Intronic
986946666 5:13029297-13029319 GGGAAGAAGGGGAAGAAGAAGGG + Intergenic
986946678 5:13029330-13029352 GGGAAGAAGGGGAAGAAGAAGGG + Intergenic
987095434 5:14545518-14545540 CGCAAGAAGGGGAAGGAGGGAGG - Intergenic
987109531 5:14672363-14672385 ATGAAGAAGGGGTACTGGGAGGG - Intronic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987606392 5:20141316-20141338 CACAAGAAGGGAGAGTAGGAAGG + Intronic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
989344448 5:40413521-40413543 CTCAAGAAAGAGAAATAGGAAGG + Intergenic
990125027 5:52505040-52505062 ATGAGGAAGGGAAAGAAGGAAGG + Intergenic
990375757 5:55168816-55168838 CTCCAGAAGGGGTAGAAGGAAGG + Intronic
991027060 5:62041169-62041191 AAGAAGAAGGGGAAGAAGTAGGG + Intergenic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
991449036 5:66732268-66732290 TGGAAGAAAGGGCAGTAGGAAGG - Intronic
993243367 5:85419979-85420001 TTGCAAAAGGGCAAGTAGGATGG - Intergenic
993509888 5:88758041-88758063 CTCAAGGAAGGGAAGGAGGATGG - Intronic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
995470602 5:112498088-112498110 CAGAAGAAAGGGGAGAAGGAAGG - Intergenic
995637402 5:114209302-114209324 CAGAGGAAGGGGAACTAGTAAGG - Intergenic
996055113 5:118973953-118973975 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
996860705 5:128062544-128062566 CAGGTGAAAGGGAAGTAGGATGG + Intergenic
997211072 5:132077091-132077113 CTGAAGTAGAGGAAGCAAGAGGG - Intergenic
997423655 5:133788168-133788190 CTGGAGAAGGGGACGTGAGATGG + Intergenic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
997990358 5:138540019-138540041 CTGAATAAAGGGAAGTATGTTGG - Intronic
998228313 5:140343620-140343642 CTGAAGCATGGAAAGAAGGAGGG - Intronic
998383780 5:141744216-141744238 CAGAAGAGAGGGAGGTAGGATGG + Intergenic
999047500 5:148485004-148485026 AGGAAGAAAGGGAAGGAGGAAGG + Intronic
999051124 5:148524851-148524873 TTGAAGAGGTGGTAGTAGGATGG + Intronic
999269597 5:150289036-150289058 CTGAGAAAGGGGAGGTAGGGAGG + Intronic
999686720 5:154109773-154109795 CTGTAAAATGGGAATTAGGATGG - Intronic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1000837612 5:166175945-166175967 CGAAAGAAAGGAAAGTAGGAAGG + Intergenic
1000865535 5:166509658-166509680 CTGAAGAAGGACAAGAAAGAGGG + Intergenic
1001132781 5:169078532-169078554 GTGAAGTTGGTGAAGTAGGAAGG - Intronic
1001421436 5:171590201-171590223 GAGAAAAAAGGGAAGTAGGAAGG - Intergenic
1001732279 5:173969270-173969292 GTCAAGAAGGGGAAATAGAAGGG - Intergenic
1001735366 5:173994058-173994080 CTGAAGAAGTGGTAGTTGGTTGG + Intronic
1001753425 5:174148374-174148396 CAGAAGTGGAGGAAGTAGGAAGG - Intronic
1002083279 5:176750132-176750154 CTTCAGAAGGGGAAGGAGAAAGG + Intergenic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1005464119 6:26095191-26095213 ATGAAGAAAGTGAAGTAGGCCGG + Exonic
1006252698 6:32802534-32802556 ATGAAGAAGTGGAAATGGGAGGG - Intergenic
1007104106 6:39271660-39271682 AGGAAGAAAGGGAAGAAGGAAGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1007915132 6:45554321-45554343 CTGAAGGGAGGGAAGGAGGAGGG + Intronic
1008144401 6:47873740-47873762 TTGAAGATGGGGAAATAGCAAGG + Intergenic
1008484569 6:52021763-52021785 GAGAAGGAGGGGAAGGAGGAGGG - Intronic
1009339570 6:62537085-62537107 ATAAAGAAGAGGAAGTAAGAAGG - Intergenic
1009530548 6:64808035-64808057 GGGAAGAAGGGAAAGGAGGAAGG - Intronic
1009567306 6:65325205-65325227 ATGAAGAAGGGAGAGGAGGAGGG - Intronic
1009777447 6:68222824-68222846 CAAAAGAAGGGGAAGAAGAAGGG + Intergenic
1012632048 6:101482724-101482746 TTGAGGTAGTGGAAGTAGGAAGG + Intronic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1013556326 6:111260218-111260240 CCGACGAAGGAGACGTAGGAAGG - Intronic
1013761875 6:113528277-113528299 CTGAAGAGGTGGAAGAATGAAGG + Intergenic
1013910574 6:115271658-115271680 CTGCAGAAGGGGAAGTAAACAGG - Intergenic
1014176216 6:118334240-118334262 ATGAAGAAAGGAAAGAAGGAAGG + Intergenic
1014491355 6:122065575-122065597 ATGGAGGAAGGGAAGTAGGAAGG + Intergenic
1015102376 6:129496460-129496482 CAAAAGAAGGGGAAATAGGCCGG - Intronic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015280028 6:131423142-131423164 GTGATGAAGGTGAAGAAGGAAGG - Intergenic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016283962 6:142451795-142451817 CTGAGGAAGGGGTAGTGGGGAGG - Intergenic
1016646203 6:146411379-146411401 CTGGAGCAGAGGAAGTAAGAAGG + Intronic
1016801476 6:148173513-148173535 AAGAAGAAGGGGAAGAAGGGGGG + Intergenic
1016843038 6:148543802-148543824 CTGAAGCAGGGACAGGAGGAGGG + Exonic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017364398 6:153617034-153617056 CTGCAGAATGTGAAATAGGATGG + Intergenic
1017418884 6:154251792-154251814 GGGAAGAAGGGGAGGAAGGAAGG + Intronic
1017602073 6:156094650-156094672 GAGAAGTAGGGGAAGGAGGAAGG - Intergenic
1017645621 6:156537384-156537406 CTGGAGAAGGTGAAATAGAATGG - Intergenic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018496444 6:164351178-164351200 CTTAAGAAGGAGGAGTGGGAGGG + Intergenic
1020372906 7:7453853-7453875 CTGAAGAAGAGGAAAAGGGAAGG - Intronic
1020408908 7:7868414-7868436 GTGCAGAAGGGGAAGTAAGCAGG - Intronic
1020427006 7:8078353-8078375 CAGAAGTAGAGGCAGTAGGAGGG + Intronic
1020534147 7:9372999-9373021 CAGAAACAGGGGAAGTGGGAGGG - Intergenic
1020592818 7:10164664-10164686 CTGAAGAATCTGAAGTAGGTGGG - Intergenic
1022023709 7:26426303-26426325 CTGAGGAAAGGGAAGTGGTAGGG - Intergenic
1022525651 7:31035329-31035351 CAGCAGCAGGGGAAGAAGGAGGG + Intergenic
1022858498 7:34340823-34340845 TAGCAGAAGGGGAAGAAGGAAGG - Intergenic
1023526174 7:41106268-41106290 CTGGAGAAGGGGCGGTGGGAGGG - Intergenic
1024184863 7:46939725-46939747 CGGCAGAAGAGGAAGTTGGAGGG + Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024471092 7:49769470-49769492 TTGAAGAAAGGGAAGAAGGAAGG - Intergenic
1024756272 7:52536698-52536720 GTGAAGAAGGCTAAGTAGCAGGG - Intergenic
1025028627 7:55537811-55537833 TTGAAGTAGTGGAAGTTGGAGGG - Intronic
1027449290 7:78311490-78311512 CTAAAGAGAGGGAAGTAGTAGGG + Intronic
1027902619 7:84136915-84136937 AAGAAGAAGGGGAGGAAGGAAGG + Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028610394 7:92703946-92703968 CTGAGGCAGAGTAAGTAGGAAGG - Intronic
1029284693 7:99457622-99457644 CTGATGAAGAGGAAGCAGGGAGG + Intronic
1029444568 7:100604946-100604968 GAGAAGAAGGGGAGGTAAGATGG - Intronic
1029618113 7:101672620-101672642 AGGAAGAAGGGAAAGAAGGAAGG - Intergenic
1029869155 7:103670599-103670621 GTGAAGAATGGGAATTAGCATGG + Intronic
1030328490 7:108247740-108247762 ACGGAGATGGGGAAGTAGGAGGG - Intronic
1031043612 7:116863149-116863171 TTGAGGAGGGGGAAGTAGAAGGG - Intronic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032519610 7:132534025-132534047 CTGAAGAAAGGGAAATAAAATGG + Intronic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1034083557 7:148302700-148302722 ATGGGGAAGGGGAAGTAGGCAGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034376398 7:150648764-150648786 CTGAATGAGGGGAAGTTGAAGGG - Intergenic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035665418 8:1376574-1376596 CTGAAGAAGGGGGAGCCGGGTGG + Intergenic
1036020465 8:4839154-4839176 CTGATGAAGGGAAAGAAGGATGG - Intronic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036634250 8:10538235-10538257 CTGAAGATGGGGAAGGAAGGGGG - Intronic
1037081654 8:14795106-14795128 CAGAATAAAGGTAAGTAGGAGGG + Intronic
1037523562 8:19703060-19703082 CTGAGGCAGGGGAAGAAGGGAGG + Intronic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037804813 8:22053397-22053419 CTGAAGAAAAGGAAGGATGAGGG - Intronic
1037859107 8:22392224-22392246 CAGAAGATGGGGAACTAGGAAGG + Intronic
1038471576 8:27827830-27827852 CATAAGAAGGGGAAGTGGCAGGG - Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038889716 8:31706138-31706160 GGGAAGATGGGGATGTAGGAAGG - Intronic
1039503509 8:38034788-38034810 GGGAAGAAGGGGATGTAGGCTGG + Intronic
1040463998 8:47677881-47677903 ATGCAAAAGGGGAAGTAAGAGGG + Intronic
1040546442 8:48401626-48401648 CTGCAAAAGGGGTAGGAGGAAGG + Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041433561 8:57811632-57811654 CTGGAGAAGGGCAAAGAGGAAGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1042025259 8:64416137-64416159 CTGAAGAGGGGGAAGAAATAGGG - Intergenic
1042190282 8:66178831-66178853 AGGAGGAAGGGGAAGTGGGAAGG + Intergenic
1042212928 8:66399894-66399916 CAGAAGAGGGGCAAGTAGGGAGG + Intergenic
1042491061 8:69398366-69398388 CTGAAGGAGGGTACCTAGGAGGG + Intergenic
1043132268 8:76476031-76476053 CAGATGAAGAGCAAGTAGGATGG + Intergenic
1043383063 8:79723354-79723376 CTGAGTAAGGGGAAATAGAAAGG + Intergenic
1044311335 8:90696209-90696231 AGGAAGAAGGGGAAGCAGCATGG + Intronic
1044402237 8:91786161-91786183 GGGAAGAAGGGGAAGGAGAAGGG - Intergenic
1044480705 8:92684252-92684274 ATTAAGAATGGGAAGTAGCAAGG - Intergenic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1045305596 8:100953374-100953396 CGGAAGAAGGGGAAGGAGAAAGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046027615 8:108744487-108744509 ATGAAGAAGGGCAGGTAGGGTGG + Intronic
1046485920 8:114888393-114888415 AGGAAGAAAGGGAAGGAGGAAGG - Intergenic
1046860573 8:119086693-119086715 TTATAGAAGGGGAAGAAGGAAGG + Intronic
1046870825 8:119204382-119204404 GGGAAGAAGGGGATGGAGGAGGG + Intronic
1047218728 8:122901272-122901294 CAGAAGCAGGGGAGGTAGGTTGG - Intronic
1047749078 8:127866489-127866511 CTGAAGGAGAGGGAGTGGGAGGG - Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048288905 8:133164674-133164696 GTGAGGAAGGGGAATTAGGCAGG - Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048792325 8:138115236-138115258 AAGATGAAGAGGAAGTAGGAGGG + Intergenic
1048962457 8:139591921-139591943 CTCAGGAAGGTGAGGTAGGAGGG + Intergenic
1049002203 8:139833279-139833301 CTAAGGAAGGGGAAGTCGGCTGG - Intronic
1049126612 8:140794955-140794977 CTGAACAATGGGAAGTATGCAGG - Intronic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1050139703 9:2504545-2504567 CTGAAGAAGAGGTAGGACGAAGG - Intergenic
1050569987 9:6927812-6927834 GAGAAGAATGGGAAGTGGGAAGG - Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1051185113 9:14452336-14452358 AAGAAGGAGGGAAAGTAGGAAGG + Intergenic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1051951650 9:22641928-22641950 GTGAAGCAGGGGAACCAGGACGG + Intergenic
1051965331 9:22821576-22821598 CTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1052842125 9:33301055-33301077 CTGAGGAAGAGGATTTAGGAAGG - Intronic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1055665600 9:78549797-78549819 CTTAAAAAGTGGAAGCAGGAGGG + Intergenic
1055693122 9:78855671-78855693 CTGAAGAACCAGAAGTAGCAAGG + Intergenic
1056120169 9:83479618-83479640 CTGAAGAAAGGAAGGAAGGAAGG + Intronic
1056365484 9:85900104-85900126 CTGATGTAGGGGCAGAAGGAAGG - Intergenic
1057037204 9:91820028-91820050 AAGAAGAAGGGGCAGTAAGAAGG + Intronic
1057357979 9:94347384-94347406 ATGAAGAAGGGGAAGAAAGTGGG - Intergenic
1057649771 9:96910233-96910255 ATGAAGAAGGGGAAGAAAGTGGG + Intronic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1057904636 9:98974494-98974516 CTGACAAAGGGCAAGGAGGAGGG + Intronic
1058665767 9:107313945-107313967 GGGAAGAAAGGGAAGGAGGAAGG - Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059160667 9:112032069-112032091 GGGAAGAAGGGGAAGAAGAAGGG + Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059353858 9:113684888-113684910 CTCAAGAGGGTGAAGTGGGAGGG - Intergenic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1060459200 9:123833015-123833037 CTCAGGAAGCTGAAGTAGGAGGG + Intronic
1060553818 9:124498369-124498391 TTTGAGAAGGGGAAGCAGGAAGG + Intronic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060732346 9:126046714-126046736 AGGAAGAAGGGGAAGGAAGAGGG - Intergenic
1061722862 9:132563915-132563937 CTGAAGAAAGGGCAGAAGAAAGG - Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061746636 9:132745056-132745078 TGGAAGAAGGGGAAATAGGTGGG - Intronic
1062123625 9:134847875-134847897 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1062265291 9:135684087-135684109 CTGAAGGAAGGGAACTAGAAGGG - Intergenic
1062432726 9:136533163-136533185 CCACTGAAGGGGAAGTAGGAGGG + Intronic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1186058824 X:5681522-5681544 AGGAAGAAAGGGAAGCAGGAAGG + Intergenic
1186383312 X:9084083-9084105 CTTAAAAAAGGGAGGTAGGAGGG - Intronic
1187073544 X:15912006-15912028 CAACAGAAGGGGAAGAAGGAGGG - Intergenic
1187479899 X:19645861-19645883 CTGGAAAAATGGAAGTAGGAGGG + Intronic
1187483313 X:19678136-19678158 CTGATGAAGGCAAAGTTGGAAGG - Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188009024 X:25038713-25038735 ATGAAGAATGGAAAGAAGGATGG + Intergenic
1188232270 X:27679375-27679397 TTGAAGAAGGGGAAGTAATTTGG + Intronic
1188471287 X:30542528-30542550 CTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1188519288 X:31020108-31020130 CTGAAGAGGAGGAATAAGGAGGG + Intergenic
1188694334 X:33171264-33171286 TTGAGAAAGGGGAAGTAGTAGGG + Intronic
1189170809 X:38907514-38907536 CTGCAGAAGGTTCAGTAGGAAGG + Intergenic
1189504298 X:41595495-41595517 CTCAAGATGGGGAGGTAGGAGGG + Intronic
1190026737 X:46930809-46930831 GAGAATAAGGGTAAGTAGGAGGG - Intronic
1190132782 X:47766416-47766438 CTGAACAAGAGAAAGTTGGAGGG - Intergenic
1190511037 X:51174714-51174736 CTGAAGAGGGGGAAATGGGAAGG + Intergenic
1192179770 X:68909198-68909220 AGGAAGAAGGGAAAGAAGGAGGG - Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1192726216 X:73755620-73755642 CAGAAGAAGGGAGAGTGGGAGGG - Intergenic
1193350424 X:80457323-80457345 GTGAAGAATGGGAAATGGGAAGG + Intergenic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1194320398 X:92439748-92439770 CAGAAGAAGGGATAGTAGGAAGG - Intronic
1195681118 X:107547367-107547389 GTGGAGAAGGGGAAGTAGAAGGG - Intronic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1196711100 X:118764063-118764085 CTTAAGAGGGGGAAGTAAGCGGG + Intronic
1197160156 X:123313876-123313898 CTGGAGAAGGGGCAGCAGGGTGG + Intronic
1197516715 X:127441142-127441164 CTGGAGAAGGGGAACAAGTAAGG - Intergenic
1197816610 X:130504700-130504722 AGGAAGAAGGGAAAGAAGGAAGG - Intergenic
1197816632 X:130504779-130504801 AGGAAGAAGGGAAAGAAGGAAGG - Intergenic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1197899374 X:131353711-131353733 TTGAAGAAGGGGAGGTGGAACGG + Intronic
1197917202 X:131548916-131548938 GTGAAGAAGTGGCAGAAGGAAGG - Intergenic
1198147739 X:133874454-133874476 CTTAAAAAGGAAAAGTAGGATGG - Intronic
1199038812 X:143085757-143085779 AAGAAGAAAGGGAAGAAGGAAGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1200063109 X:153492303-153492325 CTGAGGAGGGGGGAGTGGGAGGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200628515 Y:5552882-5552904 CAGAAGAAAGGATAGTAGGAAGG - Intronic
1202143234 Y:21751070-21751092 CTAAAGTAGGGGAAGCAGGAGGG - Intergenic
1202196292 Y:22301134-22301156 CTGAAGGAAGGAAAGAAGGAAGG + Intergenic