ID: 903338251

View in Genome Browser
Species Human (GRCh38)
Location 1:22638893-22638915
Sequence CACCTTGCCGGGGTTTCCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903338251_903338271 24 Left 903338251 1:22638893-22638915 CCTCTGGAAACCCCGGCAAGGTG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 903338271 1:22638940-22638962 CTCGGAGCCCGTGGCATCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 151
903338251_903338259 -3 Left 903338251 1:22638893-22638915 CCTCTGGAAACCCCGGCAAGGTG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 903338259 1:22638913-22638935 GTGGGCTACCCAGGGCCCAGCGG 0: 1
1: 0
2: 2
3: 21
4: 301
903338251_903338270 23 Left 903338251 1:22638893-22638915 CCTCTGGAAACCCCGGCAAGGTG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 903338270 1:22638939-22638961 CCTCGGAGCCCGTGGCATCCCGG 0: 1
1: 0
2: 0
3: 11
4: 152
903338251_903338262 6 Left 903338251 1:22638893-22638915 CCTCTGGAAACCCCGGCAAGGTG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 903338262 1:22638922-22638944 CCAGGGCCCAGCGGCCCCCTCGG 0: 1
1: 0
2: 1
3: 40
4: 355
903338251_903338265 15 Left 903338251 1:22638893-22638915 CCTCTGGAAACCCCGGCAAGGTG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 903338265 1:22638931-22638953 AGCGGCCCCCTCGGAGCCCGTGG 0: 1
1: 0
2: 2
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903338251 Original CRISPR CACCTTGCCGGGGTTTCCAG AGG (reversed) Exonic
900202351 1:1415230-1415252 CAACTAGACGGGGTTTCCAAAGG - Intergenic
900806868 1:4773289-4773311 CACCTTGCCCTGGGTTCCAGGGG - Intronic
901473481 1:9473434-9473456 GACCATCCCGGGGTATCCAGGGG - Intergenic
903338251 1:22638893-22638915 CACCTTGCCGGGGTTTCCAGAGG - Exonic
903776591 1:25797996-25798018 CACCTTGCTGTGGTTCCCATTGG + Intergenic
906075340 1:43047997-43048019 CAACTTCCAGGGGTGTCCAGTGG - Intergenic
906499185 1:46328579-46328601 CAACTAGACGGGGTTTCCAAAGG - Intergenic
916186207 1:162135689-162135711 CACCGTCCCCGAGTTTCCAGAGG - Intronic
921927289 1:220721931-220721953 CAACTAGACGGGGTTTCCAAAGG + Intergenic
1065931153 10:30480195-30480217 CAACTAGACGGGGTTTCCAAAGG + Intergenic
1071866783 10:89743143-89743165 CATCTTGCCAGGATTTCCAGAGG - Intronic
1072151402 10:92687963-92687985 CACCTTGGAGTGGTTTCCATCGG - Intergenic
1072334944 10:94389591-94389613 CAACTAGACGGGGTTTCCAAAGG + Intergenic
1078454557 11:11465125-11465147 CACCTCGCCCAGGTTACCAGTGG - Intronic
1081328873 11:41779756-41779778 CACCTTACCTTGGTTTACAGTGG + Intergenic
1082160385 11:48883021-48883043 CACCTTGAGGGGGTGTCCTGGGG + Intergenic
1082161981 11:48897385-48897407 CACCTTGAGGGGGTGTCCTGGGG - Intergenic
1083157730 11:60835459-60835481 CACCAAGGCAGGGTTTCCAGGGG + Intergenic
1083306505 11:61764683-61764705 CACCTTGCAGGGGGAGCCAGAGG - Intronic
1084518309 11:69648167-69648189 AGCCTTGCCGGGGCTTACAGGGG + Intronic
1084660293 11:70542786-70542808 TACCCTGGCGGGGTTTCCAATGG + Intronic
1086599670 11:88617597-88617619 CACCTTGCCAGGGTTACCTGGGG - Intronic
1086973319 11:93106517-93106539 CAGCTAGACGGGGTTTCCAAAGG - Intergenic
1091658530 12:2363537-2363559 CAGTTTGCTGGGGTTCCCAGTGG + Intronic
1092180389 12:6442857-6442879 CACCTTGGCTGGGATTACAGGGG - Intergenic
1094043446 12:26141948-26141970 CACCTTGGCAGGCTCTCCAGAGG + Intronic
1096207861 12:49738485-49738507 CAACTGGACGGGGTTTCCAAAGG + Intronic
1098165332 12:67691375-67691397 CCCCTGGCCGGGCCTTCCAGTGG - Intergenic
1098248526 12:68544952-68544974 CAACTAGACGGGGTTTCCAAAGG + Intergenic
1098498305 12:71162604-71162626 CACTTTGCCAGCTTTTCCAGGGG + Intronic
1099146871 12:79057699-79057721 CACCATGCAGGGGTGTCCAAGGG + Intronic
1101587208 12:106095364-106095386 CCCTCTGCCAGGGTTTCCAGGGG - Intronic
1108188807 13:47916552-47916574 CAGCTTGAAGGGGTTTCCATTGG + Intergenic
1113130887 13:107035467-107035489 TATCTTTCCGGGATTTCCAGTGG - Intergenic
1113891882 13:113740257-113740279 CACCTTGCAGGGATTCCCATGGG - Intergenic
1114397687 14:22381589-22381611 CAACTTGCCCCGGTTTCCAGTGG - Intergenic
1122107069 14:99466356-99466378 CACCTTGCCTGGGATTTCACAGG + Intronic
1122267923 14:100555262-100555284 CACCCAGCCCGGGTTTCCACAGG - Intronic
1122564865 14:102646050-102646072 CAACTTGCCTGGGGTTCTAGGGG + Intronic
1124156015 15:27225869-27225891 CACATGGCCGGAGCTTCCAGGGG + Intronic
1129438951 15:75565179-75565201 CCCTTTGCAGGGGTTTTCAGAGG - Intronic
1132318693 15:100909404-100909426 CACAGTGGAGGGGTTTCCAGTGG - Intronic
1132718441 16:1303876-1303898 CTCCCTGCATGGGTTTCCAGGGG + Intergenic
1139441915 16:66972657-66972679 CACCTTTCCAGCCTTTCCAGAGG + Exonic
1141149479 16:81553946-81553968 CACCATGCAAGCGTTTCCAGTGG + Intronic
1142488755 17:263902-263924 CACCTCGACGGGTTTTCAAGGGG + Intronic
1145279537 17:21457681-21457703 CACCTTGCCAGGCTTTTCAGAGG - Intergenic
1145398339 17:22512805-22512827 CACCTTGCCAGGCTTTTCAGAGG + Intergenic
1148157343 17:45431700-45431722 GCCCTGGGCGGGGTTTCCAGGGG + Intronic
1148562568 17:48614278-48614300 CACCTTGCGGGCGCATCCAGGGG + Exonic
1151354138 17:73548595-73548617 AAGCTTGCTGGGGTTCCCAGTGG + Intronic
1154014002 18:10600384-10600406 CAACTAGACGGGGTTTCCAAAGG - Intergenic
1154334741 18:13456376-13456398 CACCTTGCCAGGGTTTCCCTGGG + Intronic
1162094997 19:8304995-8305017 CCCCTTGGCGGGGCTTACAGGGG - Intronic
1162996675 19:14340184-14340206 CACCGTGCCTGGCTTTGCAGAGG - Intergenic
1165074763 19:33274743-33274765 TTCCTTGCCTGGGTTTACAGTGG + Intergenic
1166158839 19:40936404-40936426 CACCTTCCAGCGGTTTCCATTGG - Intergenic
1166167781 19:41004309-41004331 CACCTTCCAGCGGTTTCCATTGG - Exonic
1167151784 19:47714176-47714198 CAGCTTGCAGGGGTGCCCAGTGG - Intronic
1167466250 19:49652279-49652301 CACCGTCCCGGTGTTTCCCGCGG - Exonic
925140019 2:1543887-1543909 CACCATGACTGTGTTTCCAGAGG - Intergenic
927929659 2:27036033-27036055 CACCTTGCCTAGGTTTGCCGTGG - Exonic
929780651 2:44954921-44954943 CTCCTTGCCTCGGTCTCCAGGGG + Intergenic
930518464 2:52434912-52434934 CAACTAGACGGGGTTTCCAAAGG + Intergenic
931665559 2:64607861-64607883 TCCCTTGGCGGGGCTTCCAGGGG + Intergenic
935375207 2:102388524-102388546 CACCTGGCCAGGCTTTCCTGGGG + Intronic
937100767 2:119266225-119266247 TACCTTGCCAGGGCTGCCAGGGG - Intergenic
938803896 2:134788249-134788271 CACCTGGAGGGGGTTGCCAGAGG - Intergenic
940823537 2:158384771-158384793 CAGCTTGAAGGGGTTTCCACTGG - Intronic
942895755 2:181052258-181052280 TACTTTGCAGGGGTGTCCAGGGG + Intronic
945198829 2:207261775-207261797 CAGCATGCTGGGCTTTCCAGTGG + Intergenic
948997394 2:241589599-241589621 AACCTTGCTGGGGTGTCAAGGGG + Intronic
1170552628 20:17490550-17490572 AACCTTGCCGGGGTCTCAGGCGG + Intergenic
1172891915 20:38271566-38271588 CACCTAGCAGGGCTTCCCAGGGG - Intronic
1175840053 20:62020998-62021020 GACCTTCCCCGTGTTTCCAGGGG + Intronic
1178473051 21:32911822-32911844 AACCCTGCCTGAGTTTCCAGTGG - Intergenic
1181377844 22:22474708-22474730 CACCTTGCTGTGGTTTCCTGGGG - Intergenic
1181415829 22:22758286-22758308 CACCTAGCAGAGGTTTCCACGGG + Intronic
1182232137 22:28846390-28846412 CACCTTCCCTGGCTTTCCTGAGG - Intergenic
1183093649 22:35540185-35540207 CACTCGGCCGGGGTCTCCAGCGG - Intergenic
1185097586 22:48819942-48819964 CACTCTGCCCGTGTTTCCAGGGG + Intronic
954749164 3:52804057-52804079 CACCCTACCTGGGTGTCCAGTGG + Intronic
956828878 3:73025986-73026008 CACCTTGCCTGGGTTTTTATAGG + Intronic
962097509 3:132307397-132307419 CAACTAGACGGGGTTTCCAAAGG + Intergenic
962806782 3:138933169-138933191 CACCCTGCCTGGGTCTCCAGGGG + Intergenic
964654154 3:159048261-159048283 CACCTTACAGGGGTTTGCAGGGG - Intronic
972275051 4:37549421-37549443 CAACTAGCTGGGGTTTCCAAAGG + Intronic
974949707 4:68573205-68573227 CAACTAGACGGGGTTTCCAAAGG - Intronic
980780066 4:137482451-137482473 CAACTTGATGGGGTTTCCAAAGG + Intergenic
986592549 5:9386473-9386495 CACCTTGCCAGGGTCCTCAGAGG + Intronic
991692098 5:69235098-69235120 CACCTTTGCGGGTTTTCCCGTGG + Intronic
998114832 5:139528499-139528521 CAACTAGACGGGGTTTCCAAAGG + Intronic
1001743774 5:174074388-174074410 CACCTAGCTTGGGTCTCCAGTGG + Intronic
1003233180 6:4272871-4272893 CACCTGGCTTGGGTTTCAAGTGG + Intergenic
1006032041 6:31183457-31183479 CAACTAGACGGGGTTTCCAAAGG - Intergenic
1008123615 6:47645155-47645177 CAACTAGACGGGGTTTCCAAAGG + Intergenic
1008638987 6:53442260-53442282 CACTTTGCTGGTGTTGCCAGTGG - Intergenic
1010317895 6:74471595-74471617 CAACTAGACGGGGTTTCCAAAGG + Intergenic
1011676878 6:89743341-89743363 CAGCTGGCTGGTGTTTCCAGGGG + Intronic
1011790594 6:90894489-90894511 CACACTGCCAGGGTTTCCTGTGG + Intergenic
1014552150 6:122801357-122801379 CATCTAGCCATGGTTTCCAGAGG - Exonic
1017838804 6:158204777-158204799 CATCTTACCGGGTTTCCCAGAGG + Intergenic
1019435823 7:1021657-1021679 CGACCTGCCGGGGTTCCCAGAGG - Intronic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1025985471 7:66446848-66446870 CAGCTTGGAGGGGTTTCCACTGG - Intergenic
1026002289 7:66569990-66570012 CAGCTTGGAGGGGTTTCCACTGG - Intergenic
1026029560 7:66778766-66778788 CAGCTTGGAGGGGTTTCCACTGG + Intronic
1027208685 7:76125395-76125417 CAGCTTGGAGGGGTTTCCACTGG - Intergenic
1027783499 7:82550179-82550201 CACCATGCCCGGGCTTCCAATGG - Intergenic
1029521858 7:101067823-101067845 CACCATGCAGGGCTTGCCAGGGG + Intergenic
1034919885 7:155071031-155071053 CACCTTGCTGGGCTTTCTGGTGG + Exonic
1035026244 7:155828276-155828298 CACCTGGCAGGGCTTTCCACTGG - Intergenic
1035096731 7:156361900-156361922 CTCCTTGCCGGGGTGAGCAGGGG - Intergenic
1037319071 8:17627076-17627098 CACCGTGCTGGGGCTCCCAGGGG + Intronic
1037981570 8:23258156-23258178 CAGCTTGCTGGGGTTTTGAGGGG + Intronic
1039797445 8:40927247-40927269 CACCATGCCTGGCTTTCCAAGGG + Intergenic
1044776904 8:95699447-95699469 CATCTTGCCCTGGATTCCAGAGG + Intergenic
1049714527 8:144083568-144083590 CACCTTGCGGGGGTGTCATGGGG + Intronic
1049748703 8:144273675-144273697 CACCTCCCCGGGGGTCCCAGCGG + Intronic
1053363217 9:37504272-37504294 CACACTGCCGGGGTTGCCATCGG + Intergenic
1056269275 9:84930679-84930701 CACCGTGGAGGGGTGTCCAGGGG + Intronic
1056455410 9:86754872-86754894 CACCTGCCCCTGGTTTCCAGGGG + Intergenic
1062353709 9:136152115-136152137 CACCTTCACGGGGTGTGCAGTGG + Intergenic
1186558582 X:10586762-10586784 CAACTAGACGGGGTTTCCAAAGG - Intronic
1187698517 X:21943133-21943155 CACCGTGCCGGTGTGTCCATGGG + Intronic
1190270405 X:48858771-48858793 CAACTAGACGGGGTTTCCAAAGG + Intergenic
1195148589 X:102043314-102043336 AACCCTGCCGGGGTTTTGAGCGG + Intergenic
1196459941 X:115919438-115919460 CAACTAGACGGGGTTTCCAAAGG - Intergenic