ID: 903342052

View in Genome Browser
Species Human (GRCh38)
Location 1:22660800-22660822
Sequence CTGCTTTTCCAGGGCTTCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903342047_903342052 14 Left 903342047 1:22660763-22660785 CCTTCTTTTGGTCTCAGTGATCT 0: 1
1: 0
2: 3
3: 67
4: 681
Right 903342052 1:22660800-22660822 CTGCTTTTCCAGGGCTTCCAGGG 0: 1
1: 0
2: 4
3: 31
4: 370
903342044_903342052 27 Left 903342044 1:22660750-22660772 CCAGCGCAGGCCTCCTTCTTTTG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 903342052 1:22660800-22660822 CTGCTTTTCCAGGGCTTCCAGGG 0: 1
1: 0
2: 4
3: 31
4: 370
903342046_903342052 17 Left 903342046 1:22660760-22660782 CCTCCTTCTTTTGGTCTCAGTGA 0: 1
1: 0
2: 4
3: 20
4: 304
Right 903342052 1:22660800-22660822 CTGCTTTTCCAGGGCTTCCAGGG 0: 1
1: 0
2: 4
3: 31
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903342052 Original CRISPR CTGCTTTTCCAGGGCTTCCA GGG Exonic
900602511 1:3509232-3509254 CGGCTCCTCCAGGGCTGCCAGGG + Exonic
900969023 1:5979285-5979307 CTGCCCTTACAGGGCTTACATGG + Intronic
902449318 1:16486539-16486561 CTGCTTCTCCAGGGCTGCCTTGG + Intergenic
902505430 1:16936738-16936760 CTGTTTCTCCAGGGCTGCCTCGG - Exonic
902670777 1:17971799-17971821 CTGCTTTCCCTGGTCTTCCTGGG - Intergenic
902819456 1:18935083-18935105 CTGCTTTTCCTTGGCTCCCTGGG - Intronic
902971917 1:20059969-20059991 CTGCTTTTCCAGCACCCCCAAGG + Intronic
903342052 1:22660800-22660822 CTGCTTTTCCAGGGCTTCCAGGG + Exonic
903808859 1:26023320-26023342 CTCCTCTTCCAGGGCTAGCAGGG - Exonic
904174041 1:28613187-28613209 CTGCTTCTTCAGGACTGCCAGGG - Intronic
904290834 1:29485036-29485058 CTGCTTTTCCAGAGCTTACATGG - Intergenic
904377507 1:30090890-30090912 CTGCATTCCCAGGGCTACGAGGG + Intergenic
904858216 1:33515856-33515878 CTTCTTTCCCAGTGCTTCCCAGG + Exonic
906459682 1:46027841-46027863 CTGCTTGTCCAGGAATTCCCGGG - Exonic
907308772 1:53527803-53527825 CTGCACTTCCCAGGCTTCCAGGG + Intronic
907990188 1:59573851-59573873 CTGAGTTTCCTTGGCTTCCAGGG - Intronic
909176665 1:72370533-72370555 CTGCTCTCCCAGTGCTTCCCAGG + Intergenic
910724092 1:90320419-90320441 AAGCTATTCCAGAGCTTCCAGGG - Intergenic
911993524 1:104733607-104733629 CTGCGTTTCCAGGTGTTCCTAGG - Intergenic
912048181 1:105487472-105487494 ATACTTTTCCTGGACTTCCAAGG - Intergenic
914956316 1:152165792-152165814 ATGCTATTCAAGGCCTTCCATGG + Intergenic
916005371 1:160654662-160654684 GTGGTTATCCAGGGTTTCCAGGG - Intergenic
916348961 1:163827121-163827143 CTGCTTTTCCAGCCTTCCCATGG + Intergenic
918239252 1:182607371-182607393 CTGCTTTTCACTGGCTACCATGG - Intergenic
918251629 1:182708321-182708343 CTTCCTTTCCATGGCTTCCTGGG - Intergenic
919247414 1:195005951-195005973 CTGCTTTTCCAGTTCTGCCTTGG + Intergenic
920460406 1:206135316-206135338 CTCCCTTTCCTGGGCATCCAGGG - Intergenic
920733954 1:208514181-208514203 ATGCTTTAACAGGGCCTCCAGGG + Intergenic
920745530 1:208624437-208624459 CTGCTTTCCCTGGTGTTCCATGG + Intergenic
922370043 1:224900899-224900921 CTGCTTTCACAGGACCTCCAAGG + Intronic
922524012 1:226283655-226283677 CTGCTTTTCCAGGCCAGGCATGG + Intronic
922746697 1:228048240-228048262 CTGCTCTCCCAGGGCCTCGAGGG + Intronic
923251422 1:232182397-232182419 ACGTTTATCCAGGGCTTCCAGGG + Intergenic
923364619 1:233247179-233247201 CTGCTTTTCCAGAGCTGCCTAGG + Intronic
923398321 1:233589817-233589839 CAGCTTTTCCAGGCCATCCATGG + Intergenic
923733386 1:236576905-236576927 CTTCTTTTACGGGGCTTCCCAGG + Exonic
1062852199 10:753265-753287 CTGGCTTTCCAGGGCTCCCTTGG - Intergenic
1065024143 10:21525810-21525832 CTGCTTTTCCTGGGCTGCTGGGG - Intergenic
1065060838 10:21899261-21899283 CTGCCTTGCCAGGGATCCCAGGG - Intronic
1065321421 10:24513606-24513628 CTGAATTTCCTGGGCCTCCATGG - Intronic
1065612485 10:27485879-27485901 CTGATTTTCCTTGGGTTCCATGG + Intergenic
1066276093 10:33870339-33870361 CTGCTTTTTCAGAATTTCCAGGG + Intergenic
1067069312 10:43120399-43120421 CTTCTCCTCCAGGGCCTCCAGGG + Intronic
1068543281 10:58319909-58319931 CTGACTTTCCAGGGCTTACCAGG + Intergenic
1068760319 10:60700510-60700532 CTTCTTTTGCAGGGTTTCCCTGG - Intronic
1069390874 10:67933209-67933231 CTTCTTTTCCTTGGGTTCCAAGG + Intronic
1070281348 10:75051097-75051119 CTGCTCTCCTAGGCCTTCCAGGG - Intronic
1070292834 10:75132051-75132073 CTCCTTTGCCTAGGCTTCCAAGG - Intronic
1071886056 10:89951820-89951842 CGCCTTTTCCAGGCCTTCCATGG - Intergenic
1072033526 10:91543252-91543274 CTACTTGTACAGGGCTTTCAGGG - Intergenic
1072402819 10:95122613-95122635 CTGCTTTTCCTGGCTCTCCATGG + Intergenic
1073733589 10:106320374-106320396 GTGCTTTTCCAGGCCCACCATGG + Intergenic
1073978057 10:109122708-109122730 ATGCTATTCTAGGGCTGCCATGG - Intergenic
1075486503 10:122826354-122826376 CTGCTTTTCCTTGGCCTCCATGG - Intergenic
1076599542 10:131647953-131647975 CTGCTTTTCAGGGCCTTCCGAGG - Intergenic
1078672630 11:13378358-13378380 CCACTGTTCCAGGGATTCCAGGG + Exonic
1078753227 11:14184920-14184942 CTGGTCTTCCATGGGTTCCACGG - Intronic
1078908802 11:15711964-15711986 CTGTGTTGCCAGGGCTTCCTTGG - Intergenic
1079521925 11:21338522-21338544 CAGAGTTTCCAGGGTTTCCAGGG + Intronic
1080783204 11:35449889-35449911 CTGCTTTTCCTTGCTTTCCATGG + Intronic
1081983108 11:47282369-47282391 CTGCTTCCCCAGGGTTGCCATGG + Exonic
1083243486 11:61407511-61407533 CTGCTTTTCCAGAGGATACATGG + Intronic
1083877672 11:65532837-65532859 CTGGTTTTCCAAGGCTTGGAGGG + Intronic
1084680121 11:70662120-70662142 CTGATTTTCCCGGGCTTCCCTGG - Intronic
1084778102 11:71390482-71390504 CTGCTTTTCCATGTCGACCAGGG + Intergenic
1085535935 11:77217544-77217566 CTGCTTTCTGAGGACTTCCATGG - Intronic
1085667317 11:78426272-78426294 CAACTTTTCCATGGGTTCCACGG - Intergenic
1085731382 11:79001989-79002011 CTGCTTTTCTGGTGCATCCAGGG + Intronic
1086022146 11:82243226-82243248 CTACTTTTCCAGGTCTTTGAGGG + Intergenic
1087291254 11:96322952-96322974 CAGATTCTCCAGGGGTTCCAAGG - Intronic
1087971867 11:104494226-104494248 CTGGGGTTCCAAGGCTTCCATGG - Intergenic
1088033695 11:105285162-105285184 CTCCTTTTCCAGATCTTACAGGG - Intergenic
1088398903 11:109400928-109400950 CTTCTTTTCCAGGCCATCCCTGG - Intergenic
1089644968 11:119872971-119872993 CTGCTTTCCCTGGGGGTCCAAGG - Intergenic
1090085413 11:123645992-123646014 CTGCATCTCCACTGCTTCCAGGG - Intronic
1090973632 11:131663657-131663679 CGGCTTTGCCAGGGCTGCCAAGG - Intronic
1091453357 12:587292-587314 CTGCATTGCCAGGGGTTCCTGGG - Intronic
1091906516 12:4193944-4193966 CAGCTTCTCCAGGTCCTCCACGG + Intergenic
1092512329 12:9170408-9170430 CTGCCTTTCCAGGGATCCCAGGG - Intronic
1093445086 12:19247861-19247883 CTGTTATTCTAGAGCTTCCAGGG - Intronic
1094002954 12:25716003-25716025 AAGCATTGCCAGGGCTTCCAGGG + Intergenic
1095303519 12:40614357-40614379 CTGCCTTGCCAGGGATCCCAGGG + Intergenic
1096220784 12:49827409-49827431 CTGGTTTTCCAGGCATCCCAGGG - Intronic
1098872964 12:75837035-75837057 CTGGTTCCCCAGGGCTTCCTTGG + Intergenic
1101432498 12:104638124-104638146 CTCCTTTTCCCCTGCTTCCAAGG - Intronic
1104592870 12:130098727-130098749 CTGCTGTTCCAGGGCATGCTGGG - Intergenic
1104954184 12:132456443-132456465 CTGAGTCCCCAGGGCTTCCACGG - Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1109135164 13:58640205-58640227 TTGCTTTTCCATGGGTTCTAAGG + Intergenic
1112025509 13:95407527-95407549 CAGTTTTTCCAGGGCTTGGAAGG - Intergenic
1112379887 13:98878840-98878862 AGGCTTTTCCAAGGCTTCCTCGG + Intronic
1112574646 13:100624479-100624501 CTGCTTGTCGATGGCTTTCAAGG - Intronic
1113264546 13:108602968-108602990 CTGCTTAACCAGGGCTTAAATGG - Intronic
1113541047 13:111109930-111109952 ATTCTTTTCCATTGCTTCCAAGG - Intergenic
1113617472 13:111691260-111691282 CAGCTTGGCCAGGGCTTCCTAGG + Intergenic
1113623002 13:111776520-111776542 CAGCTTGGCCAGGGCTTCCTAGG + Intergenic
1114334254 14:21671571-21671593 CACATTTTCCAAGGCTTCCAGGG - Intergenic
1116821903 14:49634625-49634647 CTGCTTCTCGACGGCCTCCAGGG + Exonic
1117745561 14:58865855-58865877 CTGGTTCTCCAGGTCTTACAGGG - Intergenic
1118744255 14:68762580-68762602 TTGCTCTTCCACAGCTTCCAGGG + Intergenic
1120232304 14:81853225-81853247 CTGCTTTTCCAGGTATGCCCTGG - Intergenic
1120835695 14:89036806-89036828 TTGCCTTTCCAAGACTTCCAGGG - Intergenic
1120865319 14:89291439-89291461 CAGCTTATCAAAGGCTTCCACGG + Intronic
1122244159 14:100389776-100389798 CTGCTTTGCCAGGGCTTGTGGGG + Intronic
1122545402 14:102519042-102519064 CTGCCTGTCTTGGGCTTCCAAGG - Intergenic
1126170646 15:45692748-45692770 CTTCTTTTCCTGGGATGCCAAGG + Intergenic
1126712188 15:51471315-51471337 CATCTTTTACAGGCCTTCCAGGG + Exonic
1127212278 15:56785500-56785522 CTGCATTTCCAGGACTTGGAAGG - Intronic
1129717663 15:77861582-77861604 CCAATTTTCCAGGGCTTCCTCGG + Intergenic
1130528954 15:84731120-84731142 CTGCTTTTCCAGTACTTTCCTGG + Intergenic
1130918720 15:88326153-88326175 CTTCTTCTCTAGGACTTCCATGG - Intergenic
1132024811 15:98396190-98396212 CTGCCTTTCAAGGGCTTCTCTGG + Intergenic
1132146472 15:99432636-99432658 CGGCTTTCTCAGGGCTTCCCTGG - Intergenic
1132311888 15:100863229-100863251 ATGGTTTTCCAGGGATGCCAGGG - Intergenic
1132930004 16:2454240-2454262 CTGCTTCCCCAGGGCTCCCCAGG - Intronic
1133469494 16:6060835-6060857 CTGTTTTTCCAGGGCTGCCTGGG + Intronic
1133784080 16:8962127-8962149 CTGCTTTTCCTGAGCTCCCCTGG + Intronic
1134467485 16:14492263-14492285 CTGCTTTCTCAGGGCCTCCATGG + Intronic
1134626153 16:15724347-15724369 CCCCTCTTCCAGAGCTTCCACGG + Exonic
1136108928 16:28052575-28052597 CTGATTTTCCATGGCTGTCAAGG - Intronic
1136236879 16:28919795-28919817 CTGCTTCTCCAGGGAGTCCAGGG + Exonic
1136412494 16:30085501-30085523 CAGCTTGCCCAGGGCCTCCAGGG + Intergenic
1137576228 16:49602150-49602172 CTGTTATTTCGGGGCTTCCAGGG - Intronic
1137602687 16:49767331-49767353 CTGCTTTCCCCGGCCTTCCCTGG - Intronic
1139392636 16:66614584-66614606 CCGCTTTGCCAGGGCTTACAAGG - Intergenic
1141604559 16:85145424-85145446 CTGGCTTTCCAGGGCTTGCGGGG + Intergenic
1141879341 16:86847490-86847512 CTGCCTTTCCGAGTCTTCCAAGG + Intergenic
1142198659 16:88750758-88750780 CAGCCTTTCCGGGGCTACCAGGG + Intronic
1142200885 16:88760661-88760683 CTGCCTGTCCTGGGCTTCCTGGG - Intronic
1142422077 16:89977703-89977725 CTCCTGTTCCAGTGCTTCCAGGG + Intergenic
1144328746 17:14206119-14206141 CTCTTTCACCAGGGCTTCCAGGG - Intronic
1144447064 17:15341278-15341300 ATGCTTTTCAAGGGTTTTCAAGG - Intronic
1144506435 17:15835181-15835203 CTGGTTATTCAGGGCTACCATGG - Intergenic
1145170611 17:20653114-20653136 CTGGTTATTCAGGGCTACCATGG - Intergenic
1145289476 17:21531871-21531893 CTGCTTTTCTATGGTTTCCATGG - Exonic
1145752753 17:27367117-27367139 CAGCTTGTCCAGGGCTTTCCTGG - Intergenic
1145768450 17:27475544-27475566 CAGCTTTTACAGAGCTCCCACGG + Intronic
1147129436 17:38398192-38398214 CTCCCTTTCCAGGGCTCCTAGGG - Intronic
1147474746 17:40700019-40700041 CTCAATTTCCAGGGCTTGCAGGG + Exonic
1147644667 17:42026697-42026719 CTCCTTTCGCAGGCCTTCCAGGG - Intronic
1148739281 17:49883133-49883155 CTAATTTTCCAGAGCTTCCTTGG - Intergenic
1149157577 17:53650359-53650381 CTGTTTTCCCAGAGCTTACAGGG + Intergenic
1150396345 17:64824825-64824847 CTGCTTTTGCAAGGCTTTCACGG + Intergenic
1150649696 17:67001718-67001740 CTGCTCTTCCAGGACTTCAGGGG + Intronic
1151329659 17:73399279-73399301 CTCCTTTTCCAGAACTCCCAGGG - Exonic
1152577626 17:81149743-81149765 CTGCTTGTCCAGGGTTTCTTCGG + Intronic
1152690196 17:81714465-81714487 CTGCCTTTCAAGGCCTTCTATGG + Intronic
1154092843 18:11381150-11381172 CTGCTGTGCCAAGGCTGCCAGGG - Intergenic
1156954406 18:42944002-42944024 CTGCTTTTCCTGCCCCTCCAGGG + Intronic
1158096977 18:53784042-53784064 CTCCTTTTCCAGGTGTTTCAAGG + Intergenic
1159682835 18:71375961-71375983 ATGATTTTCCATGACTTCCATGG + Intergenic
1160116256 18:76082109-76082131 CTGCTTTTCCAGGACTTAACTGG + Intergenic
1160337914 18:78059344-78059366 CTCCTTAGCCAGGGCTACCATGG + Intergenic
1160492670 18:79351144-79351166 ATGCTTTTCTATGACTTCCAAGG - Intronic
1160537698 18:79603813-79603835 GGGCTTTTCCAGGGCCTGCAGGG + Intergenic
1160996659 19:1885233-1885255 CTGCAGTCCCAGGGCTTCCGCGG - Intronic
1161028539 19:2047632-2047654 CTGCTTTCCCACGGCCTCCTGGG + Intronic
1161486685 19:4539675-4539697 CTCCTCCTCCAGGGCTTCCCTGG + Intronic
1161531536 19:4792744-4792766 CAGCAATTCCAAGGCTTCCACGG - Exonic
1162606183 19:11709871-11709893 CTGCCTTTCCAGCACTGCCATGG + Intergenic
1163311309 19:16516624-16516646 TCGCTTTCACAGGGCTTCCAGGG - Intronic
1164401590 19:27905692-27905714 TTGGTTTCCCAGGGCTTCCCTGG + Intergenic
1164406679 19:27954236-27954258 ATAATTTTCCTGGGCTTCCATGG + Intergenic
1164934020 19:32197276-32197298 CTGGTTTGCCAGGGCTTTCTGGG - Intergenic
1165090565 19:33386054-33386076 CTGCTTGTCCAGTTCTCCCAGGG - Intergenic
1167613458 19:50518219-50518241 CTGCGTCTCCAGGGTCTCCACGG + Exonic
925393295 2:3513825-3513847 CTTCTTTTCCAGGTAATCCAGGG + Intronic
926541545 2:14186105-14186127 CTGCTTTTCCAATGTTTCTATGG + Intergenic
927342776 2:22001588-22001610 CTGCATTCCCAGTGGTTCCATGG + Intergenic
928708949 2:33982712-33982734 CTACTTTTCCTTGGCTCCCAAGG - Intergenic
929457205 2:42074463-42074485 CTCCTTGCCCATGGCTTCCAGGG - Intergenic
929672205 2:43885447-43885469 TTCCCTTTCCAGGGCTTCCACGG - Intergenic
929944850 2:46362546-46362568 CTTTTTTTCCTGGGGTTCCATGG - Intronic
932188812 2:69721343-69721365 ATGCCTTTGCAGTGCTTCCAGGG - Intronic
932615332 2:73227807-73227829 CTGGCTTCCCAGGGCTTCCTTGG + Intergenic
934560860 2:95312663-95312685 CTGATTTACCAGAGCGTCCATGG + Intronic
934681203 2:96285180-96285202 CTGCTCTGCCAGGGCCTCCATGG + Exonic
934709017 2:96503232-96503254 CTGCTTCTCAAGGGCTCCCAGGG - Intronic
936706375 2:115079622-115079644 CTGCTTTTCCTGTGGTCCCATGG - Intronic
937317535 2:120941507-120941529 CTGCTCTCCCAGGGCCTCCCTGG - Intronic
938192319 2:129295050-129295072 CTCCTTATTCAGTGCTTCCAGGG + Intergenic
938840991 2:135163331-135163353 CTCCTTTTCTAGGGATTCCTTGG + Intronic
940656870 2:156497946-156497968 CTTCTTTCCCAGGCCTTCAAGGG - Intronic
942475189 2:176311878-176311900 CTGCTTTTCCTAGCCCTCCATGG + Intronic
943442143 2:187938444-187938466 TTTCTTTTACAGGGCTGCCAAGG - Intergenic
943529623 2:189063036-189063058 CTGCTTCTCCAGGTTTCCCAGGG + Exonic
944466890 2:200010886-200010908 CTTCTCTTCCAGAGCTACCAGGG - Intergenic
944668447 2:201975639-201975661 ATTCCTTTCCAGGGTTTCCAGGG - Intergenic
944898613 2:204191413-204191435 CTGCTTTTCCAGGGGCTTAAAGG + Intergenic
946648669 2:221868223-221868245 CTGCTTTTCCAGAATTCCCAGGG - Intergenic
947315958 2:228858686-228858708 CTGATTTTCCAGGTCATTCATGG - Intronic
948559902 2:238845910-238845932 CTGCCCTTCCAGGGCGTCCCCGG + Intergenic
948769072 2:240238777-240238799 CTCCTTTTCCAGGGATTTCCTGG + Intergenic
1172218764 20:33257390-33257412 CTCATTTTCCATGGCCTCCAAGG - Intergenic
1172503592 20:35444556-35444578 CTCCCTTTCCAGGGCTTATAAGG - Intronic
1174694472 20:52543188-52543210 CTGATTTTCCAGGTCTGTCATGG - Intergenic
1174925329 20:54753032-54753054 CTGCCTTACCAGAGCTCCCAAGG - Intergenic
1175391167 20:58628341-58628363 CTGCTTTCACATGGCTGCCAGGG + Intergenic
1175461562 20:59155587-59155609 CAGCTTTACCTGGACTTCCAAGG - Intergenic
1175585456 20:60135737-60135759 CTGCTTTTCCAGGGTTTCCTAGG - Intergenic
1176215553 20:63946090-63946112 CTACTTTTGCAGGGGGTCCAGGG + Intronic
1176454654 21:6898164-6898186 CAGCAATTCCAAGGCTTCCATGG - Intergenic
1176832827 21:13763212-13763234 CAGCAATTCCAAGGCTTCCATGG - Intergenic
1178123900 21:29497043-29497065 CTGCTATTCCAGGCATTCCAAGG + Intronic
1178124071 21:29498708-29498730 CTGCTATTCCAGGCATTCCAGGG - Intronic
1179283180 21:39952480-39952502 GTGCTTTTACAGAGCTTCCCAGG - Intergenic
1182845472 22:33427431-33427453 CTGCTTTTCCAAAGCCTACATGG - Intronic
1183794832 22:40108129-40108151 CTGCCTTGCCATGGCTTCCCAGG - Intronic
1185183913 22:49381227-49381249 ATCCTTTCCCAAGGCTTCCAGGG + Intergenic
949271525 3:2223316-2223338 CTGCTTTTCCCATGCTTCCTAGG + Intronic
950792031 3:15479582-15479604 CTGGTTTTCCAGTGGCTCCATGG + Intronic
950810542 3:15646261-15646283 CAGCTCATCCAGGGATTCCAGGG + Intergenic
951709326 3:25573197-25573219 CTGTTCTTCCAGTGCTTCCTGGG + Intronic
952998416 3:38907501-38907523 CTCCTTTCCCAGTGCTTCCTGGG + Intronic
953552841 3:43917768-43917790 TTGCTCTTCCAGCCCTTCCAGGG + Intergenic
954217963 3:49134858-49134880 CTGCTGCTCCAGGGCCTGCAGGG + Intergenic
954370064 3:50165629-50165651 CTGCTTCTCCAAAGCTCCCAGGG - Intronic
954966808 3:54619132-54619154 CAGCTTTTCCCAGGCTTTCAGGG + Intronic
954994109 3:54866114-54866136 GTGCTTTTCCATGCCCTCCAAGG + Intronic
956959236 3:74378846-74378868 TTGCTTTTGTAGGGCTACCATGG + Intronic
957077888 3:75616039-75616061 CTGCCTTCTAAGGGCTTCCAAGG + Intergenic
958529595 3:95309537-95309559 CTGCTTCTGCAGGGCCTGCATGG + Intergenic
960075565 3:113481143-113481165 CTGATTTTCTAGGGGTTCCTAGG - Intronic
960738827 3:120810456-120810478 ATGCTTTTTCATGGATTCCAGGG + Intergenic
961045757 3:123706838-123706860 CTCCTTTTCAAGGGCTTGCTAGG - Intronic
961379042 3:126485467-126485489 CTGAGTAGCCAGGGCTTCCAGGG - Intronic
961554729 3:127690188-127690210 CTGCTTTTCCTGAGTTCCCATGG + Exonic
962654913 3:137533340-137533362 CTGCATTTCCAAGACTTACAAGG + Intergenic
963084879 3:141427548-141427570 CTGCTTTACCAAGGCTTCTAAGG - Intronic
963718852 3:148836741-148836763 ATGCTTCTCCAGGATTTCCAGGG - Intronic
963922930 3:150923483-150923505 ATGCTTCTCTAGGGCTCCCAAGG - Intronic
966509586 3:180747084-180747106 CTCCTTTTCCAGGCCCTTCAGGG + Intronic
967154725 3:186681898-186681920 CTTCTTCTCCAGGGACTCCAGGG + Intergenic
968793968 4:2689777-2689799 CAGCTGCGCCAGGGCTTCCACGG - Intronic
968850549 4:3074824-3074846 CAGCTTTTCCAGGGTCGCCATGG - Exonic
969109807 4:4837178-4837200 CGGCTTTTCCAGGGATTCTCAGG - Intergenic
969153591 4:5191138-5191160 CTGGTTTTCCCTGGTTTCCATGG + Intronic
969233039 4:5845198-5845220 CTGCTTTTCAAGGCCCTGCAGGG + Intronic
969392400 4:6900597-6900619 CTGCTGTTCCTGGGCCTCCAGGG + Intergenic
969583831 4:8080741-8080763 GTGCTTGTCCAAGGCTACCAGGG + Exonic
969596612 4:8152630-8152652 CTGCTCTTTCGGGGCTTCCCCGG + Intronic
972802086 4:42487292-42487314 CTGCTTTCCCAGCTCTTCAAAGG + Intronic
973205196 4:47552050-47552072 GTGCTTTTCAAGGTCTTCTATGG + Intronic
973781234 4:54290006-54290028 TTGCCTTTCCAGGGCTTGGATGG - Intronic
974129768 4:57739455-57739477 ATGTTTTTCCTTGGCTTCCATGG - Intergenic
975278338 4:72529392-72529414 CTGTTTTAGCAAGGCTTCCAGGG + Intronic
975719462 4:77235896-77235918 CTGCTTTTCCACGGCTCACCTGG + Intronic
976175286 4:82345931-82345953 CTGCCTTTACAGGGCTTACTGGG + Intergenic
976357327 4:84133366-84133388 CAGATTTTGCAGGCCTTCCAAGG + Intergenic
978323529 4:107524815-107524837 CTCATTTCCCAGGGCTTTCAAGG - Intergenic
980022962 4:127730949-127730971 CTGCTTTTCCAGGGCCGCGTTGG + Intronic
981225469 4:142289250-142289272 ATACTTTTCTAGGCCTTCCAGGG + Intronic
982068673 4:151675975-151675997 CTGCCTGTCCTGGGTTTCCAAGG + Intronic
983521350 4:168712214-168712236 CCCCTTTTCCATGGCCTCCAGGG - Intronic
983524667 4:168748854-168748876 CTGCTTCTTCAAGGCTTTCAAGG + Intronic
984857221 4:184205620-184205642 CTGCTTTCCCAGGGCTGCTCTGG + Intronic
984961272 4:185100534-185100556 CTGCTATTCCCTGGCTTCCCCGG - Intergenic
987692357 5:21283413-21283435 CTGCGTTTCCAGGTGTTCCTGGG + Intergenic
987991954 5:25224253-25224275 TTGTTTTTCCCAGGCTTCCAAGG - Intergenic
988705537 5:33722958-33722980 CTGCTTTTCTTGGGCTTCCAGGG - Intronic
991748000 5:69766637-69766659 CTGCGTTTCCAGGTGTTCCTGGG - Intergenic
991799577 5:70346485-70346507 CTGCGTTTCCAGGTGTTCCTGGG - Intergenic
991829020 5:70663553-70663575 CTGCGTTTCCAGGTGTTCCTGGG + Intergenic
991891936 5:71345914-71345936 CTGCGTTTCCAGGTGTTCCTGGG - Intergenic
992658153 5:78930896-78930918 CTGCGTTCCCAGGCCCTCCACGG + Intronic
992845520 5:80743175-80743197 CTGCTTCTCCAGGGGTGTCAGGG + Intronic
995237698 5:109849059-109849081 CTGCCTTGCCAGGGCTTCTATGG + Intronic
995372917 5:111439742-111439764 CTGCTTTTTCTGTGTTTCCAGGG - Intronic
997832922 5:137167136-137167158 CTGCTCTTTTATGGCTTCCATGG - Intronic
998171812 5:139877011-139877033 AGGCCTCTCCAGGGCTTCCATGG + Intronic
999324157 5:150632745-150632767 CTACTCTTTCAGGGATTCCAAGG - Intronic
1001272514 5:170325714-170325736 CTGTTCTTCCATGTCTTCCAGGG - Intergenic
1001316867 5:170649396-170649418 CTTTTGTTCCAGGGCATCCATGG + Intronic
1002324029 5:178393943-178393965 CTGATTTTCCAAGGGTGCCAAGG + Intronic
1002495135 5:179606556-179606578 CTGCTTTTGCATTGCTGCCACGG - Intronic
1004402838 6:15304789-15304811 CTGTTTTTCCTGGGAGTCCATGG + Intronic
1004631597 6:17426602-17426624 CAGCTTGTCAAAGGCTTCCACGG - Exonic
1005410343 6:25538834-25538856 CTCCATTTCCATGGCGTCCAGGG - Intronic
1006296379 6:33171810-33171832 CTGCTTTCTCAGGGCTCCCCTGG - Exonic
1006470640 6:34226876-34226898 CTGCTCTTCCAGGGAGTCCCGGG + Intergenic
1006516946 6:34550468-34550490 CTGCTTCCCCAGGGTCTCCAAGG + Intronic
1006921116 6:37627817-37627839 CTGCTTTTGGGGGGGTTCCAGGG + Intergenic
1008544357 6:52572774-52572796 CTGCTAGTACATGGCTTCCATGG - Intronic
1009066051 6:58563989-58564011 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009066276 6:58567049-58567071 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009066931 6:58576225-58576247 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009071752 6:58643443-58643465 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009071969 6:58646500-58646522 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009075259 6:58692355-58692377 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009076563 6:58710697-58710719 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009078762 6:58741252-58741274 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009080706 6:58768265-58768287 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009081363 6:58777416-58777438 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009083115 6:58801879-58801901 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009084215 6:58817145-58817167 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009085097 6:58829376-58829398 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009086846 6:58853816-58853838 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009087066 6:58856873-58856895 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009092763 6:58936288-58936310 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009094950 6:58966861-58966883 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009096483 6:58988264-58988286 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009097368 6:59000491-59000513 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009098469 6:59015773-59015795 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009099127 6:59024921-59024943 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009099572 6:59031032-59031054 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009101771 6:59061607-59061629 CTGTTTTTGCAGGATTTCCAAGG + Intergenic
1009101991 6:59064664-59064686 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009106567 6:59128335-59128357 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009108331 6:59152770-59152792 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009108550 6:59155829-59155851 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009108770 6:59158887-59158909 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009109209 6:59165001-59165023 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009114459 6:59238331-59238353 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009114680 6:59241388-59241410 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009115117 6:59247501-59247523 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009116220 6:59262793-59262815 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009119071 6:59302319-59302341 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009120122 6:59317077-59317099 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009120344 6:59320132-59320154 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009120563 6:59323190-59323212 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009122535 6:59350537-59350559 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009124299 6:59374963-59374985 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009126488 6:59405520-59405542 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009135579 6:59531943-59531965 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009138655 6:59574735-59574757 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009139698 6:59589178-59589200 CTGTTTTTGTAGGGTTTCCAAGG + Intergenic
1009141016 6:59607528-59607550 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009143667 6:59644154-59644176 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009145864 6:59674702-59674724 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009146748 6:59686934-59686956 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009150911 6:59745013-59745035 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009152670 6:59769472-59769494 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009156865 6:59827808-59827830 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009497186 6:64365451-64365473 CTGATTTTCCAGAGCTTCAGAGG - Intronic
1011820721 6:91250274-91250296 CTTGTTTTCCTGGGCTTGCATGG + Intergenic
1013832041 6:114284591-114284613 CTTCTTTTCCCTGGGTTCCATGG - Intronic
1014774091 6:125488699-125488721 CTGCTTTTACAAGAATTCCAAGG + Intergenic
1015796994 6:137023089-137023111 CTGCCCTTGCAGAGCTTCCAGGG + Intronic
1015827634 6:137331707-137331729 CAACTTTTCCAGGGATTTCATGG + Intergenic
1016667273 6:146656876-146656898 ATGTGTTCCCAGGGCTTCCAGGG - Exonic
1017756288 6:157532054-157532076 CTCCTTCCCCAGTGCTTCCATGG - Intronic
1017935340 6:159000077-159000099 CTGCTCTTCCAGGGTGTCCTCGG + Exonic
1018172435 6:161153113-161153135 CTGCTTTTCCTGGGGTGCCCAGG - Intronic
1018411333 6:163551797-163551819 CTGCTCTTACAAGACTTCCAAGG - Intronic
1020275162 7:6619843-6619865 CTGTTTTTGCAGGGCCTCCCAGG + Intronic
1021487404 7:21182548-21182570 CTGATGTTCCAGAGCTTCCAAGG + Intergenic
1021577266 7:22115958-22115980 CTGCTGTTCAGGGTCTTCCAGGG + Intergenic
1022323636 7:29309937-29309959 CTGCCTGGCCAGTGCTTCCAGGG - Intronic
1022892065 7:34711631-34711653 GTACTTTTCCAGAGCTTCCCAGG + Intronic
1024503902 7:50144969-50144991 CTGCTTTTTCAGGCCTGGCACGG + Intronic
1024551237 7:50564181-50564203 CCACTTTGCCAGGACTTCCAGGG + Intronic
1024653397 7:51428381-51428403 CTGCTTTTCCAGGATTTCTGTGG + Intergenic
1026966948 7:74446159-74446181 CTGCTGATCCAGAGCTCCCAGGG + Intergenic
1028505515 7:91566125-91566147 TTGCTTTTCCAGAGCTGTCAGGG - Intergenic
1029470441 7:100751182-100751204 CTTATTTTCAAGGGCATCCAGGG + Exonic
1029674855 7:102061472-102061494 CTGTTTTCCAAGGGCTGCCACGG + Intronic
1031890840 7:127291819-127291841 CTGATTTTCCAGCTCTTTCAAGG + Intergenic
1032242440 7:130174467-130174489 CTGCTTTTCTAGGGTTGCTATGG - Intronic
1032370351 7:131343764-131343786 CTGCTTTTCCGGGGCATACAGGG + Intronic
1032432355 7:131872299-131872321 CTGCCAGTCAAGGGCTTCCAGGG - Intergenic
1035812495 8:2504403-2504425 CTGCTGTTCCAGGGCCTCCCTGG + Intergenic
1036684422 8:10899725-10899747 CTGGTTTTCTGAGGCTTCCAAGG + Intronic
1038411587 8:27363286-27363308 CTGCTCTCCCAGGCCTTCCCTGG - Intronic
1039997909 8:42550445-42550467 CTGTTTTTCTAGAGCCTCCAAGG + Intronic
1041100203 8:54389165-54389187 CTGCTTTTACAGGACTTCCAGGG - Intergenic
1041615182 8:59898830-59898852 CTGCTTTTCTCGGTTTTCCATGG - Intergenic
1042320852 8:67474083-67474105 TTGCTTTTCTATGGCTTCCATGG - Intronic
1042437223 8:68780994-68781016 CTTATTTTACAGGGATTCCATGG + Intronic
1044428811 8:92084819-92084841 CTGCTTTGCCAGGCCTTTCCTGG - Intronic
1047777127 8:128081665-128081687 CTGCTCTTCTATGGCTTCCATGG + Intergenic
1048474956 8:134734604-134734626 CTGCTTCTCCAGTGCTCCCCTGG - Intergenic
1049549514 8:143250560-143250582 CTGCTTTTCCGGGGGTCCCCAGG - Exonic
1049776178 8:144406408-144406430 CTGCCTTCCCTGGGCCTCCAGGG + Intronic
1050766595 9:9142196-9142218 CTGCTCTTCTAGGGCTTCTATGG - Intronic
1052444917 9:28548046-28548068 CTGCTTTTCCATAGCTTCCTTGG - Intronic
1052927316 9:34028722-34028744 ATGCTTTTCAAGAGATTCCAGGG - Intronic
1053019841 9:34687185-34687207 CTTCATTTCCCAGGCTTCCAGGG + Intergenic
1053560630 9:39190269-39190291 CTGCCTGTCCAGGCCTTCGAGGG - Intronic
1054136489 9:61428686-61428708 CTGCCTGTCCAGGCCTTCGAGGG + Intergenic
1054867267 9:70015209-70015231 CTGTTTCTTCATGGCTTCCAAGG + Intergenic
1055640437 9:78315199-78315221 CTGCTTTGCCAGGGGCTGCAGGG - Intronic
1056187592 9:84150899-84150921 CAGTTTTTCCAGGGATTCCTGGG + Intergenic
1056564663 9:87760208-87760230 GTGCTTACCCAGGGCTTGCAGGG - Intergenic
1056823734 9:89862665-89862687 CTGTTCTTGCTGGGCTTCCAAGG - Intergenic
1056889471 9:90477601-90477623 CTGCCATTCCTGGGCTGCCAAGG + Intergenic
1057410765 9:94815055-94815077 TTGCTTTGCCAGGGCTTTCTTGG + Intronic
1058579087 9:106435428-106435450 CTGCTCTTCCAGGTCTTCACTGG + Intergenic
1061014354 9:127973349-127973371 CTGCTTGTCCAGGGGTGGCAGGG - Intronic
1061066953 9:128284364-128284386 CTGCATTTCCAAGCCTTCCTTGG - Intronic
1061130318 9:128704509-128704531 CTGATTACCCAGGGCTGCCAGGG + Intronic
1061235066 9:129337339-129337361 TTTCTTTTCTTGGGCTTCCAGGG + Intergenic
1061568092 9:131457652-131457674 CTCCTTTTCCAGACCATCCATGG + Intronic
1061651655 9:132055084-132055106 CTGCCTTCACAGCGCTTCCAGGG - Intronic
1061667069 9:132166783-132166805 CTGCCTCTCCAGGGCTTCTCTGG + Exonic
1062133925 9:134914774-134914796 CTGCCTTTCCAGGGGCTCCAGGG + Exonic
1186513353 X:10147761-10147783 CTTCTTTCTCAGGGCTTCCCTGG + Intergenic
1186830656 X:13386854-13386876 CTGAGTTTCCAAGGCCTCCAGGG + Intergenic
1189429277 X:40932699-40932721 CTGTTTTTCAAGGGCTCCAAAGG - Intergenic
1191627144 X:63281643-63281665 CTGATTTTGGAGGACTTCCAAGG - Intergenic
1195772098 X:108362460-108362482 CTTCTTTTCAAGTGATTCCAGGG + Intronic
1196144022 X:112297054-112297076 CTGCCTTTCCCTGCCTTCCAGGG + Intergenic
1197944758 X:131827202-131827224 CAGCTTTTAGAGGGCTTACAAGG + Intergenic
1198582517 X:138081634-138081656 CTGCTTTCCAAGGGGTCCCAGGG + Intergenic
1199811382 X:151353164-151353186 CTGCTTTCCCTGGGTTCCCAAGG - Intergenic
1200827786 Y:7661107-7661129 CGGCTTGTGCTGGGCTTCCAGGG - Intergenic
1201452212 Y:14128972-14128994 CTGGTATTCCAGGCCTTTCATGG - Intergenic