ID: 903343045

View in Genome Browser
Species Human (GRCh38)
Location 1:22666684-22666706
Sequence GGAGTACTGACTTGGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903343045_903343050 12 Left 903343045 1:22666684-22666706 CCTGACTCCCAAGTCAGTACTCC No data
Right 903343050 1:22666719-22666741 CGTCTGCCAGATCCCAACCTTGG No data
903343045_903343051 13 Left 903343045 1:22666684-22666706 CCTGACTCCCAAGTCAGTACTCC No data
Right 903343051 1:22666720-22666742 GTCTGCCAGATCCCAACCTTGGG No data
903343045_903343053 20 Left 903343045 1:22666684-22666706 CCTGACTCCCAAGTCAGTACTCC No data
Right 903343053 1:22666727-22666749 AGATCCCAACCTTGGGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903343045 Original CRISPR GGAGTACTGACTTGGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr