ID: 903344159

View in Genome Browser
Species Human (GRCh38)
Location 1:22673672-22673694
Sequence TAGCCCGGCCAGGAGCTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903344159_903344168 29 Left 903344159 1:22673672-22673694 CCGCTCAGCTCCTGGCCGGGCTA No data
Right 903344168 1:22673724-22673746 CTCCCTCGTTGCCCCTTGGCAGG No data
903344159_903344167 25 Left 903344159 1:22673672-22673694 CCGCTCAGCTCCTGGCCGGGCTA No data
Right 903344167 1:22673720-22673742 TTTTCTCCCTCGTTGCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903344159 Original CRISPR TAGCCCGGCCAGGAGCTGAG CGG (reversed) Intergenic
No off target data available for this crispr