ID: 903344162

View in Genome Browser
Species Human (GRCh38)
Location 1:22673687-22673709
Sequence GCAGAGCATGCCGGGTAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903344162_903344179 26 Left 903344162 1:22673687-22673709 CCGGGCTACCCGGCATGCTCTGC No data
Right 903344179 1:22673736-22673758 CCCTTGGCAGGCAGGGGGTGGGG No data
903344162_903344172 19 Left 903344162 1:22673687-22673709 CCGGGCTACCCGGCATGCTCTGC No data
Right 903344172 1:22673729-22673751 TCGTTGCCCCTTGGCAGGCAGGG No data
903344162_903344174 21 Left 903344162 1:22673687-22673709 CCGGGCTACCCGGCATGCTCTGC No data
Right 903344174 1:22673731-22673753 GTTGCCCCTTGGCAGGCAGGGGG No data
903344162_903344167 10 Left 903344162 1:22673687-22673709 CCGGGCTACCCGGCATGCTCTGC No data
Right 903344167 1:22673720-22673742 TTTTCTCCCTCGTTGCCCCTTGG No data
903344162_903344168 14 Left 903344162 1:22673687-22673709 CCGGGCTACCCGGCATGCTCTGC No data
Right 903344168 1:22673724-22673746 CTCCCTCGTTGCCCCTTGGCAGG No data
903344162_903344177 25 Left 903344162 1:22673687-22673709 CCGGGCTACCCGGCATGCTCTGC No data
Right 903344177 1:22673735-22673757 CCCCTTGGCAGGCAGGGGGTGGG No data
903344162_903344171 18 Left 903344162 1:22673687-22673709 CCGGGCTACCCGGCATGCTCTGC No data
Right 903344171 1:22673728-22673750 CTCGTTGCCCCTTGGCAGGCAGG No data
903344162_903344173 20 Left 903344162 1:22673687-22673709 CCGGGCTACCCGGCATGCTCTGC No data
Right 903344173 1:22673730-22673752 CGTTGCCCCTTGGCAGGCAGGGG No data
903344162_903344175 24 Left 903344162 1:22673687-22673709 CCGGGCTACCCGGCATGCTCTGC No data
Right 903344175 1:22673734-22673756 GCCCCTTGGCAGGCAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903344162 Original CRISPR GCAGAGCATGCCGGGTAGCC CGG (reversed) Intergenic
No off target data available for this crispr