ID: 903344168

View in Genome Browser
Species Human (GRCh38)
Location 1:22673724-22673746
Sequence CTCCCTCGTTGCCCCTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903344163_903344168 6 Left 903344163 1:22673695-22673717 CCCGGCATGCTCTGCTTTCACCC No data
Right 903344168 1:22673724-22673746 CTCCCTCGTTGCCCCTTGGCAGG No data
903344159_903344168 29 Left 903344159 1:22673672-22673694 CCGCTCAGCTCCTGGCCGGGCTA No data
Right 903344168 1:22673724-22673746 CTCCCTCGTTGCCCCTTGGCAGG No data
903344161_903344168 19 Left 903344161 1:22673682-22673704 CCTGGCCGGGCTACCCGGCATGC No data
Right 903344168 1:22673724-22673746 CTCCCTCGTTGCCCCTTGGCAGG No data
903344164_903344168 5 Left 903344164 1:22673696-22673718 CCGGCATGCTCTGCTTTCACCCA No data
Right 903344168 1:22673724-22673746 CTCCCTCGTTGCCCCTTGGCAGG No data
903344162_903344168 14 Left 903344162 1:22673687-22673709 CCGGGCTACCCGGCATGCTCTGC No data
Right 903344168 1:22673724-22673746 CTCCCTCGTTGCCCCTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903344168 Original CRISPR CTCCCTCGTTGCCCCTTGGC AGG Intergenic
No off target data available for this crispr