ID: 903344172

View in Genome Browser
Species Human (GRCh38)
Location 1:22673729-22673751
Sequence TCGTTGCCCCTTGGCAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903344163_903344172 11 Left 903344163 1:22673695-22673717 CCCGGCATGCTCTGCTTTCACCC No data
Right 903344172 1:22673729-22673751 TCGTTGCCCCTTGGCAGGCAGGG No data
903344161_903344172 24 Left 903344161 1:22673682-22673704 CCTGGCCGGGCTACCCGGCATGC No data
Right 903344172 1:22673729-22673751 TCGTTGCCCCTTGGCAGGCAGGG No data
903344162_903344172 19 Left 903344162 1:22673687-22673709 CCGGGCTACCCGGCATGCTCTGC No data
Right 903344172 1:22673729-22673751 TCGTTGCCCCTTGGCAGGCAGGG No data
903344165_903344172 -9 Left 903344165 1:22673715-22673737 CCCAGTTTTCTCCCTCGTTGCCC No data
Right 903344172 1:22673729-22673751 TCGTTGCCCCTTGGCAGGCAGGG No data
903344166_903344172 -10 Left 903344166 1:22673716-22673738 CCAGTTTTCTCCCTCGTTGCCCC No data
Right 903344172 1:22673729-22673751 TCGTTGCCCCTTGGCAGGCAGGG No data
903344164_903344172 10 Left 903344164 1:22673696-22673718 CCGGCATGCTCTGCTTTCACCCA No data
Right 903344172 1:22673729-22673751 TCGTTGCCCCTTGGCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903344172 Original CRISPR TCGTTGCCCCTTGGCAGGCA GGG Intergenic
No off target data available for this crispr