ID: 903345810

View in Genome Browser
Species Human (GRCh38)
Location 1:22683634-22683656
Sequence AGGGAGAACAGCATGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903345810_903345819 -8 Left 903345810 1:22683634-22683656 CCCCCTGCCATGCTGTTCTCCCT No data
Right 903345819 1:22683649-22683671 TTCTCCCTGGTGGTAGGGAGTGG No data
903345810_903345822 -5 Left 903345810 1:22683634-22683656 CCCCCTGCCATGCTGTTCTCCCT No data
Right 903345822 1:22683652-22683674 TCCCTGGTGGTAGGGAGTGGGGG No data
903345810_903345827 22 Left 903345810 1:22683634-22683656 CCCCCTGCCATGCTGTTCTCCCT No data
Right 903345827 1:22683679-22683701 TCATAGCACTCTATATTGTAAGG No data
903345810_903345821 -6 Left 903345810 1:22683634-22683656 CCCCCTGCCATGCTGTTCTCCCT No data
Right 903345821 1:22683651-22683673 CTCCCTGGTGGTAGGGAGTGGGG No data
903345810_903345824 -4 Left 903345810 1:22683634-22683656 CCCCCTGCCATGCTGTTCTCCCT No data
Right 903345824 1:22683653-22683675 CCCTGGTGGTAGGGAGTGGGGGG No data
903345810_903345820 -7 Left 903345810 1:22683634-22683656 CCCCCTGCCATGCTGTTCTCCCT No data
Right 903345820 1:22683650-22683672 TCTCCCTGGTGGTAGGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903345810 Original CRISPR AGGGAGAACAGCATGGCAGG GGG (reversed) Intergenic
No off target data available for this crispr