ID: 903348598

View in Genome Browser
Species Human (GRCh38)
Location 1:22703982-22704004
Sequence ACAGTGAGACAAGACTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903348585_903348598 30 Left 903348585 1:22703929-22703951 CCTGGAGACCTGAGGACAATGGT No data
Right 903348598 1:22703982-22704004 ACAGTGAGACAAGACTGGGAAGG No data
903348587_903348598 22 Left 903348587 1:22703937-22703959 CCTGAGGACAATGGTTTGGCTGG No data
Right 903348598 1:22703982-22704004 ACAGTGAGACAAGACTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903348598 Original CRISPR ACAGTGAGACAAGACTGGGA AGG Intergenic
No off target data available for this crispr