ID: 903353338

View in Genome Browser
Species Human (GRCh38)
Location 1:22731231-22731253
Sequence CGGGGGGAATGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 832
Summary {0: 1, 1: 0, 2: 2, 3: 86, 4: 743}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903353326_903353338 23 Left 903353326 1:22731185-22731207 CCTGGCAGCCAGGTTGGTGACTC 0: 1
1: 0
2: 1
3: 17
4: 157
Right 903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 86
4: 743
903353327_903353338 15 Left 903353327 1:22731193-22731215 CCAGGTTGGTGACTCTAGCATGT 0: 1
1: 0
2: 0
3: 5
4: 108
Right 903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 86
4: 743

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903353338 Original CRISPR CGGGGGGAATGGAGGGCAGA GGG Intronic
900088284 1:908809-908831 AGGGGGGAAGGGAGGGATGAGGG + Intergenic
900183768 1:1323912-1323934 CTGGGGGACTGGGGGGCTGAGGG + Intronic
900300241 1:1973449-1973471 GGGAGGGGATGGAGGCCAGAAGG + Intronic
900949097 1:5847607-5847629 GGTGGGGATTGCAGGGCAGAAGG + Intergenic
901041862 1:6368776-6368798 CCCGGGGAATGCAGGGCACAGGG + Intronic
901343014 1:8512537-8512559 AGGGGAGATTGGAGGGCAGTTGG - Intronic
901751783 1:11414404-11414426 ATGAGGGATTGGAGGGCAGAGGG + Intergenic
902581852 1:17412898-17412920 CGGGGGTACAGGAGGGGAGAGGG - Intronic
903004420 1:20289357-20289379 TGGGGGGACTGCTGGGCAGAGGG - Intergenic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903455640 1:23484672-23484694 CGGGGGGGTGGTAGGGCAGAAGG - Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904358061 1:29954250-29954272 CGGGGGGAATGGAGGGAGACTGG + Intergenic
904450065 1:30605331-30605353 TGGGGTGAGCGGAGGGCAGAGGG + Intergenic
905197919 1:36295604-36295626 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
905352529 1:37357448-37357470 CTGGGGGAATGGAGGGGCGGAGG - Intergenic
905515369 1:38558513-38558535 GGGGGGGAAAGGAGGTGAGAGGG - Intergenic
906315437 1:44784156-44784178 CGGGAGGGAAGGAGGGCAGTGGG + Exonic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907293442 1:53433479-53433501 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
907326021 1:53638957-53638979 GGCAGGGAGTGGAGGGCAGAAGG + Intronic
907459014 1:54594216-54594238 GGTGGGGAAAGGAGGGGAGAGGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907923507 1:58934599-58934621 TGGGGGGAATGGAAGGAAGGTGG + Intergenic
909005060 1:70265923-70265945 AGGGAGGAAGGGAGGGAAGAAGG + Intronic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
910474828 1:87595635-87595657 AGGAGGGAAGGGAGGGAAGAGGG - Intergenic
911995299 1:104758241-104758263 GGGGGGGAATGGGGGGAGGAGGG + Intergenic
912174462 1:107140052-107140074 CGGGGGGGATGGGGAGTAGAGGG + Intronic
912492504 1:110070095-110070117 CGGCGGGAATGGAAGGCGGGAGG - Intronic
912556084 1:110517144-110517166 AGGGAGGAAGGGAAGGCAGAAGG + Intergenic
912813416 1:112810667-112810689 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
914941036 1:152023289-152023311 GGCAGGGAACGGAGGGCAGATGG - Intergenic
915213395 1:154325740-154325762 CGCGGGGCCAGGAGGGCAGAGGG + Intronic
915420059 1:155773329-155773351 TTGGGGGGATGGTGGGCAGATGG - Intronic
915549378 1:156623795-156623817 CGGGTGGGATGCTGGGCAGAGGG - Exonic
915914167 1:159931268-159931290 AGGGGGGAATGGAGGGATGGTGG + Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916941634 1:169684077-169684099 AGGGAGGAATGGAGGGTGGAAGG - Intronic
917749493 1:178041215-178041237 ATGGGGGAATGGAGGGTGGAAGG - Intergenic
918018273 1:180659446-180659468 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
918857754 1:189780666-189780688 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
919548359 1:198951673-198951695 TTTGGGGAATGGAGGGTAGAGGG - Intergenic
919887857 1:201947838-201947860 TGGGGGGACTGAAGGGCAGAAGG + Intergenic
921063958 1:211609652-211609674 CAGGGGGCATGGAGGGCCGCAGG - Intergenic
922066862 1:222152566-222152588 AGGGGTAAAAGGAGGGCAGATGG + Intergenic
922213100 1:223500308-223500330 TGGGGGGAATGATGGGCAGGGGG + Intergenic
922363703 1:224844958-224844980 AGGGAGGAATGGAGGGTGGAAGG + Intergenic
922368294 1:224886334-224886356 AGGGAGGAATGGATGGCGGAAGG - Intergenic
922598824 1:226834497-226834519 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923452866 1:234136175-234136197 AGGAGGGAAGGGAGGGAAGAAGG - Intronic
923614334 1:235524434-235524456 AGGCGGGGAGGGAGGGCAGAAGG + Intergenic
924328674 1:242921177-242921199 GGGAGGGAATGGAGGGGAGGAGG + Intergenic
924415044 1:243849983-243850005 CGGAGGGAGTGGAGGCCAGGCGG + Intronic
1062818206 10:516419-516441 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818217 10:516439-516461 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818228 10:516459-516481 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818239 10:516479-516501 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818249 10:516498-516520 AGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818260 10:516518-516540 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818271 10:516538-516560 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818281 10:516557-516579 AGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818292 10:516577-516599 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818303 10:516597-516619 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818314 10:516617-516639 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818325 10:516637-516659 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818335 10:516656-516678 AGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818346 10:516676-516698 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818357 10:516696-516718 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062818368 10:516716-516738 GGGGGGGAAGGGAGGGGAAAGGG + Intronic
1062832285 10:613930-613952 CTGGAGGAAGGCAGGGCAGATGG - Intronic
1063122559 10:3115029-3115051 TGGAGGGCACGGAGGGCAGATGG + Intronic
1063455343 10:6178756-6178778 GGGGGGGATTTGAAGGCAGAGGG + Intronic
1063484867 10:6410448-6410470 GGGAGGAAATGTAGGGCAGAGGG + Intergenic
1063566629 10:7177061-7177083 TGGGGGGACTGGAGAGCAGGTGG - Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1065497259 10:26341983-26342005 GGGGAGGAGTGGAGGGAAGAAGG + Intergenic
1066103514 10:32137900-32137922 AAGGGGAAATGGAGGGCGGAAGG + Intergenic
1066198970 10:33127966-33127988 AGGGGGGAAGGGAGGGGAGGGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067061929 10:43082082-43082104 CTTGGGGAATGGAGGGGAGCGGG - Intronic
1067158906 10:43806171-43806193 CTGGAGGAAGGGAGGGCAGCAGG - Intergenic
1067452205 10:46388688-46388710 CAAGGGGAATGGGGGGCAGAGGG + Intronic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067585032 10:47471067-47471089 CAAGGGGAATGGGGGGCAGAGGG - Intronic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1068866777 10:61903178-61903200 GCGGGGGAGGGGAGGGCAGAGGG + Intronic
1069095620 10:64256081-64256103 AGGGAGGAATGGAGGACAAAAGG - Intergenic
1069707155 10:70466030-70466052 CGGGGAGGCTGGAGGGGAGAGGG + Intergenic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1069776520 10:70930340-70930362 TGGGGGGAATTGAGGGCTCAGGG - Intergenic
1069861267 10:71473153-71473175 AGGCGGGAATGGAGGCCAGGAGG - Intronic
1069894487 10:71672144-71672166 TGGGGGTCAGGGAGGGCAGAAGG + Intronic
1069942259 10:71964082-71964104 CCCGGGGACTGGAGGGCCGAGGG + Intergenic
1070161125 10:73867385-73867407 CGGGGGGCATGGAGAACAGACGG - Intronic
1070383381 10:75902075-75902097 TGGGGGGAATGTGGGGCTGAAGG - Intronic
1070777005 10:79115647-79115669 TGGGGGGAACTGAGGGCTGAGGG + Intronic
1070976421 10:80609350-80609372 CGGAGGGAGAGGAAGGCAGAGGG - Intronic
1071187087 10:83058393-83058415 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1071488657 10:86121048-86121070 GGAGGGAAATGGAGGGCATAAGG - Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1071897875 10:90085490-90085512 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1072821177 10:98559399-98559421 GGGGGAGAATAGAGGACAGAAGG - Intronic
1072910762 10:99498837-99498859 CGAAGGGAATGGAGAGGAGAAGG - Intergenic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073191859 10:101657071-101657093 CGGGAGGATTGGAGGGAGGAGGG - Intronic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073394428 10:103206437-103206459 AGGGAGGAATGGAGGGTGGAAGG - Intergenic
1073683384 10:105728582-105728604 AGGGAGGAATGGAGGGTGGAAGG - Intergenic
1074740631 10:116481907-116481929 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1075124514 10:119688978-119689000 AGGGGGGTATTGAGCGCAGATGG + Intergenic
1075148053 10:119900026-119900048 TGAGGGGAAGGGAGGGAAGAGGG - Intronic
1075221147 10:120585860-120585882 CGGGGGGATTGGAGGACAGCAGG - Intronic
1075624332 10:123950882-123950904 TGGGGGGAAGGAAGGGAAGAAGG + Intergenic
1075719547 10:124576706-124576728 CGGGGGTACTGGGGGGCTGAGGG + Intronic
1075729384 10:124627279-124627301 CCCGGGGCATGGAGGGCACAGGG - Intronic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1075960245 10:126562269-126562291 AGGGGGTAAGGGAGGGCAGGGGG - Intronic
1076034080 10:127184456-127184478 ATGGGGGAATGGAGAGCTGAGGG - Intronic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076658411 10:132039359-132039381 AGGGGGCAAGGCAGGGCAGACGG - Intergenic
1076988928 11:259145-259167 GGGGTGGGGTGGAGGGCAGAGGG - Intergenic
1077344209 11:2038971-2038993 GGGGTGGCATGGAGGGCACAGGG + Intergenic
1077500889 11:2909364-2909386 CGGGGGGACTGGAGTCCAGGTGG + Intronic
1077506328 11:2931461-2931483 CGGGGGTACTGGAGGCCAGGAGG + Intergenic
1077644600 11:3912206-3912228 AGGGGAGAAGGGAGGGGAGAAGG - Intronic
1077766533 11:5164763-5164785 AGGGAGGAATGGAGGGTGGAAGG + Intronic
1077923073 11:6655824-6655846 CGGGGGGAGGGGAGGGGAGGGGG - Exonic
1078493829 11:11796310-11796332 CAGGTGGAATGGAGAGGAGAGGG - Intergenic
1078638662 11:13075717-13075739 GGAGGGGAAATGAGGGCAGAGGG - Intergenic
1078646012 11:13141951-13141973 CGGGGGAAATGGAAGGAAGCCGG + Intergenic
1078670134 11:13357253-13357275 TGGAGAGCATGGAGGGCAGAAGG - Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080614339 11:33932961-33932983 GAGAGGAAATGGAGGGCAGAGGG - Intergenic
1080647511 11:34197543-34197565 TGGGGGGCGGGGAGGGCAGAGGG + Intronic
1080664085 11:34320352-34320374 CTGGGGGAATTGAAGTCAGAAGG + Intronic
1080779111 11:35414524-35414546 CGGGGTGAGGGGCGGGCAGAGGG + Intronic
1081734062 11:45391296-45391318 TGGGGGGATTGGAGGGCGGTTGG + Intergenic
1081831663 11:46120543-46120565 GGGGAGGGGTGGAGGGCAGAGGG + Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1083276042 11:61597703-61597725 ATGGGGAAATGGGGGGCAGAGGG - Intergenic
1083853006 11:65378807-65378829 AGGGGTGGATGGAGGGAAGAGGG - Intronic
1084177199 11:67429046-67429068 AGGGGGGAATGGAGTGGGGAAGG + Intronic
1084205047 11:67586324-67586346 CTGGAGGAATTGGGGGCAGAGGG - Intronic
1084268186 11:68015499-68015521 AGGGGGGCATGGAGGGCAGCTGG + Intronic
1084436456 11:69144332-69144354 CGGGGTGGATGGGGGGCACAGGG + Intergenic
1084555922 11:69875794-69875816 CGGGGTGAATGGAGGGGTGAGGG - Intergenic
1084566499 11:69931705-69931727 TGGGGGGCATTGTGGGCAGAGGG - Intergenic
1084642607 11:70434720-70434742 AGAGGGGAAGGGAGGGCAGGCGG + Intronic
1085011220 11:73142642-73142664 CGTGGGGGAGGGAGGGCAGGAGG - Intergenic
1085311973 11:75522261-75522283 AGGGGGAAATGGAGGCCTGATGG + Intronic
1085315021 11:75539592-75539614 CTGGGAGATTGGAGGGCAGGGGG + Intergenic
1085396646 11:76210031-76210053 CGGGGGGAAAGGGTGGCAAAAGG - Intronic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1087237366 11:95734860-95734882 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
1087701531 11:101441315-101441337 TTGGGGAAATGGGGGGCAGATGG - Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088828932 11:113518809-113518831 CTTGGAGAATGGAGGGCAGCTGG - Intergenic
1089190804 11:116651862-116651884 TGGGGGGCATGGGGTGCAGAGGG + Intergenic
1089251742 11:117168416-117168438 CGGGGGGAATGAAGGGGAAAGGG - Exonic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089735890 11:120550083-120550105 TGCGGGGAATGGGCGGCAGAGGG + Intronic
1090432197 11:126655437-126655459 TGGGGGGAGTGGAGGGGTGAAGG - Intronic
1090623585 11:128585298-128585320 GGGAGGGAAGGGAGGGAAGAAGG + Intronic
1090809434 11:130223690-130223712 CCGGGGGAGTGGGGGGCAGGAGG + Intergenic
1202827195 11_KI270721v1_random:94160-94182 GGGGTGGCATGGAGGGCACAGGG + Intergenic
1091584993 12:1811059-1811081 CGAGAGGGATGGAGGGCAGGGGG - Intronic
1091590004 12:1837227-1837249 CGGTGGGAGGGGAGGGCAGTTGG + Intronic
1091668999 12:2439025-2439047 TGGGGGCAATGGAGTGGAGAGGG - Intronic
1091701668 12:2667359-2667381 CTGGGGGAAGGGAGACCAGAGGG + Intronic
1092149280 12:6236086-6236108 CGGGAGAACTGGTGGGCAGAGGG - Intronic
1092264516 12:6970559-6970581 CGGCGGCACTGGAGGTCAGAAGG + Exonic
1093024176 12:14231823-14231845 AGGGAGGAATGGATGGTAGAAGG - Intergenic
1093322131 12:17724737-17724759 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1093612739 12:21182528-21182550 GGGAGGGACTGGCGGGCAGAAGG - Intronic
1093961425 12:25277016-25277038 GGGGGGTATTGCAGGGCAGAGGG + Intergenic
1094220118 12:27983918-27983940 TGGGGGGAAAGGATGGAAGATGG + Intergenic
1094589074 12:31804405-31804427 TGGGAGGGAAGGAGGGCAGAAGG - Intergenic
1094627147 12:32135043-32135065 GGAGGGGAATGGAGGGGAGGAGG - Intronic
1095818383 12:46450003-46450025 CGGGGGGAGGGGGTGGCAGAGGG - Intergenic
1095943113 12:47739104-47739126 AGGGGGGAATGGAGGGATGGAGG + Intronic
1095952732 12:47790388-47790410 CGGGGGGCATGATGGGGAGATGG + Intronic
1096101248 12:48971628-48971650 CGGGAGGAAGGGAGGGAGGAAGG + Exonic
1096760295 12:53836137-53836159 AGTGGGGAATGGAGGGAAGCCGG + Intergenic
1096846137 12:54408076-54408098 AGTGGGGAAGGGATGGCAGAGGG - Intronic
1096854130 12:54467116-54467138 AGTGGGGAATGGAGAGCTGATGG - Intronic
1097268003 12:57756678-57756700 TGGGGGGATTAGAGGGGAGAAGG - Intronic
1097373669 12:58815330-58815352 AGTGGGGAACAGAGGGCAGATGG + Intergenic
1097542345 12:60956446-60956468 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1098653973 12:73006445-73006467 AGGGAGGAATGGAGGGTGGAAGG + Intergenic
1101736203 12:107465198-107465220 TCGGGGCACTGGAGGGCAGACGG - Intronic
1103241920 12:119420573-119420595 AGTGGGGGATGGGGGGCAGAAGG + Intronic
1103933676 12:124463887-124463909 CGGCAGGAAGGGAGGGGAGATGG - Intronic
1104041383 12:125133608-125133630 CAGGGGCAGTGGAGGGCACAGGG - Intronic
1104544411 12:129698552-129698574 AGGGGAGAAGGGAGGGGAGAAGG + Intronic
1104544417 12:129698564-129698586 AGGGGAGAAGGGAGGGGAGAGGG + Intronic
1104612430 12:130240700-130240722 CCGGGTGAAGGGAGGGAAGAGGG + Intergenic
1104668902 12:130667145-130667167 AGGGAGGAAGGGAGGGAAGAAGG + Intronic
1104842604 12:131832053-131832075 CGGGGGGAAGGGAAGGGGGAAGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1106144840 13:27041242-27041264 CAGGGAGACTGCAGGGCAGATGG - Intergenic
1106547522 13:30743511-30743533 GAGGGGGAATGGAGGGCACTGGG - Intronic
1106737425 13:32602233-32602255 TGAGGGGAAGGGAGGGGAGAGGG - Intronic
1106834205 13:33616175-33616197 GGAGGGAAATGGAGGGGAGAAGG + Intergenic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1107007510 13:35630936-35630958 AGGGGGGAATGGTGGGAAGTGGG - Intronic
1107788488 13:43977802-43977824 GGGAGGGAAGGGAGGGGAGAGGG - Intergenic
1108299645 13:49061438-49061460 GGAGGGGAAGGGAGGGGAGAAGG - Intronic
1108299679 13:49061510-49061532 GGAGGGGAAGGGAGGGGAGAGGG - Intronic
1109211787 13:59543704-59543726 AGGGAGGGAGGGAGGGCAGAAGG + Intergenic
1110542716 13:76723823-76723845 TGGGGTGAGTGTAGGGCAGATGG - Intergenic
1110641526 13:77830203-77830225 AGGGGGGGAGGGAGGGAAGAAGG - Intergenic
1110650663 13:77938143-77938165 CAGGAGGAATGGAGGGTGGAAGG + Intergenic
1111616765 13:90669845-90669867 TGGGGTGAGTGGAGGGCGGAGGG + Intergenic
1111791749 13:92865502-92865524 TGTGGGGAAGGGAGGGGAGATGG + Intronic
1112359925 13:98708151-98708173 GGTGGGGAATGGTGGGGAGAGGG + Intronic
1113409273 13:110070208-110070230 GGTGGGGAAGGGAGGGCAGAGGG - Intergenic
1113409287 13:110070241-110070263 GCTGGGGAAGGGAGGGCAGAGGG - Intergenic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113811090 13:113143144-113143166 AGGGGGGAATGGATGGCAAGGGG - Intronic
1113847014 13:113397994-113398016 CGGGGGGAAGGGAGGGAGAAGGG + Intergenic
1114464359 14:22910497-22910519 GGGGGGGAAAGGAAGGGAGAAGG + Intronic
1115724174 14:36194708-36194730 GAGGGGGAAGGGAGGGGAGAGGG + Intergenic
1116689396 14:48085325-48085347 CGGGGAGAATGGAAGCAAGAGGG + Intergenic
1117105485 14:52393957-52393979 GGGCGGGAAGGGAGGGCACAGGG - Intergenic
1118420887 14:65602123-65602145 CGGGGGAAATGGTGGGAAGGAGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119383857 14:74245304-74245326 AGGGGAGAGTGGAGGGGAGAGGG - Intronic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1120205001 14:81578717-81578739 CAGGGGGAAGGAAGGGGAGAAGG + Intergenic
1120251541 14:82065542-82065564 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1120666379 14:87311266-87311288 CGGGAGGCATGGAGGGAGGAAGG - Intergenic
1120928113 14:89818466-89818488 AGGGAGGAAGGGAGGGAAGAAGG + Intronic
1120949497 14:90028025-90028047 CTGGGGGAATGCAGTTCAGAAGG - Intronic
1121022046 14:90586197-90586219 CGGGAGGAAAGCAGCGCAGACGG - Intronic
1121378778 14:93441730-93441752 CAGGAGGCATGGAGGGCATATGG - Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121777794 14:96602170-96602192 AGGGGGGATTGGAGGGCTGCAGG + Intergenic
1121963181 14:98280468-98280490 AGGGTGGGGTGGAGGGCAGACGG - Intergenic
1122507479 14:102240870-102240892 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1122864033 14:104595514-104595536 TGTGGGGCATGGGGGGCAGAGGG - Intronic
1122864065 14:104595629-104595651 TGTGGGGCATGGGGGGCAGAGGG - Intronic
1122939095 14:104973300-104973322 CGGGGGCCAGGGAGGGCTGAGGG + Intronic
1122972489 14:105158080-105158102 CGGGGGGAGAGGTGGGCAAAGGG + Intronic
1123099290 14:105785266-105785288 CGGGGGCCAAGGCGGGCAGATGG - Intergenic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1123811427 15:23930177-23930199 CATGGGGAATGGAGGTCAGTGGG + Intergenic
1125065036 15:35472463-35472485 TGGGGAGATTGGAGGGCACAAGG - Intronic
1125697657 15:41652302-41652324 AGAGGGGAGGGGAGGGCAGAGGG - Intronic
1125985510 15:44047327-44047349 GGAGGGGAAAGGAGGGGAGAGGG + Intronic
1126530303 15:49703595-49703617 AGGGAGGAATGGAGGGTGGAAGG + Intergenic
1126803563 15:52322391-52322413 TGGGAGGCATGGAGGGCAGTTGG + Intronic
1126835961 15:52665106-52665128 CGAGGGGAATGGAGGGAGGCAGG + Intronic
1128637506 15:69312619-69312641 CGGGGGGACTGGACAGGAGAAGG - Intronic
1128668531 15:69556859-69556881 CGGGGGCAGCGGAAGGCAGAAGG - Intergenic
1129162155 15:73752957-73752979 CGAGGGGAAGGGAGGGGAGGGGG + Intergenic
1129389436 15:75213322-75213344 CGGCGGGAAGGGAGGACCGAAGG - Intergenic
1129846576 15:78770576-78770598 CGGGGGTACTGGAGGGCTGGAGG + Intronic
1130042550 15:80417565-80417587 AGGGAGGAAGGGAGGGGAGAAGG - Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130255340 15:82323378-82323400 CGGGGGTACTGGAGGGCCGGAGG - Intergenic
1130379904 15:83362654-83362676 TGGGGTGACTGGAGGGCAGAGGG - Intergenic
1130599625 15:85266608-85266630 CGGGGGTACTGGAGGGCCGGAGG + Intergenic
1130839216 15:87682050-87682072 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
1130946266 15:88552606-88552628 CGGGGCGGCTGGCGGGCAGAGGG + Intergenic
1131008284 15:88996390-88996412 CGGGGGCAAGGGAAGGGAGAGGG - Intergenic
1131164707 15:90134038-90134060 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1131376333 15:91927153-91927175 TCGGGGGAGTGGAGGGCCGAGGG - Intronic
1131447586 15:92512766-92512788 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1132262864 15:100441534-100441556 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1132618247 16:852751-852773 CAGGGGGCATGGAGGGCTGTTGG + Intergenic
1132626585 16:894346-894368 CGGGGGGACAGGTGGGCGGACGG - Intronic
1133050707 16:3115822-3115844 CGGGGGGAGGGGAGGGCTGTGGG - Exonic
1133305433 16:4805198-4805220 AGGGGGGATTGGAGGGGTGAGGG + Exonic
1133663052 16:7937510-7937532 GGGGAGGAAGGGAGGGAAGAAGG - Intergenic
1133701186 16:8310636-8310658 GGGGGTGCATGAAGGGCAGAAGG + Intergenic
1133813240 16:9177386-9177408 AGAGGGGAAGGGAGGGGAGAAGG - Intergenic
1135025560 16:18996634-18996656 AAGGGGGAATGGAGGGCGGAAGG + Intronic
1135681790 16:24463476-24463498 TGGGGGGAAAGGAGGGGAGATGG + Intergenic
1135762480 16:25148338-25148360 CGGGGAGAATTGACGGCACATGG - Intronic
1137055532 16:35744765-35744787 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1137561654 16:49506303-49506325 ATGGGGGAATGGATGGTAGACGG + Intronic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138239503 16:55415688-55415710 CTTGGAGGATGGAGGGCAGATGG + Intronic
1138309297 16:56009499-56009521 CAGGGAGAATGGTGGGCAGTAGG + Intergenic
1138318317 16:56089374-56089396 AGGTGGGAATGGAGCTCAGAGGG + Intergenic
1139134525 16:64185822-64185844 GGGGTGGAATGGAGGGGAGTGGG - Intergenic
1139593062 16:67943840-67943862 CGGGGCTTATGCAGGGCAGAAGG + Exonic
1140974486 16:80045768-80045790 CGGGGGGAAAGCAGGGGAGAAGG - Intergenic
1140981283 16:80112152-80112174 AGCAGGGAATGGAGTGCAGAGGG + Intergenic
1141080565 16:81047992-81048014 TGGGGGAAAAGGAAGGCAGAAGG + Intergenic
1142114115 16:88347624-88347646 CGGGGTGGATGTGGGGCAGATGG - Intergenic
1142285232 16:89168903-89168925 TGTGGGGCGTGGAGGGCAGAAGG - Intergenic
1142350032 16:89575664-89575686 CGGCGGGAAATGAGGGCAGGGGG - Intergenic
1142354940 16:89597813-89597835 CGGGGGGATGGGTGGACAGATGG - Intergenic
1142355091 16:89598224-89598246 CGGGGGGATGGGTGGGCGGATGG - Intergenic
1142403209 16:89871876-89871898 CGTGGGGCCTGGAGGTCAGAAGG + Intergenic
1142700934 17:1660325-1660347 CAGGTGGAATCGAGGGGAGAGGG - Intronic
1142700941 17:1660366-1660388 CAGGTGGAATTGAGGGGAGAGGG - Intronic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1146125839 17:30230711-30230733 GGTGGGGCATGGAGGGGAGAAGG + Intronic
1146422210 17:32698277-32698299 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1147265604 17:39232461-39232483 CGAGTGGACTGGAAGGCAGAGGG + Intergenic
1147741935 17:42674905-42674927 AGAGGTGAATGAAGGGCAGAGGG + Intronic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1147916472 17:43890512-43890534 GGGTTGGAGTGGAGGGCAGAGGG - Intronic
1147978124 17:44259455-44259477 CGAGGGGTGTGGAGGGCTGAGGG + Intronic
1148076782 17:44941714-44941736 CCCGGGGAAGGGAAGGCAGAGGG + Intronic
1148204797 17:45773548-45773570 TGGGGGGGATGGGGGGCAGGGGG - Intergenic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1148869543 17:50648302-50648324 CTCGGGGATTGGAGGGCTGAAGG + Intronic
1148906071 17:50913114-50913136 TGTGGGGAGTGGAGGGCACAAGG - Intergenic
1148950461 17:51306490-51306512 CGGGGGGAATGGAGCCAAGTTGG + Intergenic
1150380599 17:64716659-64716681 CGGGGCGGATGCTGGGCAGAGGG - Intergenic
1151606764 17:75142559-75142581 AGGGGGGAGGGGAGGGGAGAGGG + Intronic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1151629496 17:75300940-75300962 CGTGGGGAAAGGAGGGAAAAAGG - Intergenic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1152790040 17:82273810-82273832 CGGGGTAACAGGAGGGCAGAGGG - Intergenic
1153162998 18:2229719-2229741 CGGGGGGAAAGGATGGGAGGGGG + Intergenic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1156391280 18:36652736-36652758 GGGGGTGACAGGAGGGCAGATGG - Exonic
1156461949 18:37326203-37326225 CGAGGGCAAGGGAGAGCAGAGGG + Intronic
1156683914 18:39621542-39621564 GAGAGGGAATGGAGGGCAGTTGG - Intergenic
1156771700 18:40735565-40735587 TGGGGTGAAGGGAGGGAAGAGGG - Intergenic
1157085207 18:44573436-44573458 AAGGGAGAATGGAGGGTAGAAGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1158297916 18:56019543-56019565 GGTGGAGAATGGAGGGGAGATGG + Intergenic
1158453354 18:57586387-57586409 CGCGGAGAAGGGAGGGCTGAGGG - Intronic
1158528177 18:58234263-58234285 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1159029253 18:63214134-63214156 CGGGAGAAATGGAAGGGAGAGGG + Intronic
1159356114 18:67338437-67338459 AGGGAGGAAAGGAGGGAAGAAGG - Intergenic
1159487448 18:69082495-69082517 AGGGGGGAAGGAAGGGAAGAAGG + Intergenic
1159881082 18:73859122-73859144 AGGGGGGCATGCAGGGAAGAAGG + Intergenic
1160292480 18:77607248-77607270 CGTGGGGAATGGAGCCCAGGCGG + Intergenic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1160612185 18:80097138-80097160 AGGGGGACATGGAGGGCAGGCGG - Intergenic
1160663774 19:313393-313415 CAGGGGCCAGGGAGGGCAGAGGG - Intronic
1161112229 19:2476863-2476885 TGGGGGGAGGGGAGGGCACACGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161711828 19:5853036-5853058 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
1161766111 19:6209868-6209890 AGGAGGGAAGGAAGGGCAGATGG - Intergenic
1162541105 19:11296487-11296509 CAGGAGGGATGTAGGGCAGACGG + Intronic
1162573429 19:11485417-11485439 CGCGGGGATAGGAGGGAAGATGG + Intronic
1162594011 19:11613138-11613160 GGGGGGGAAGGGAGGGGAGGGGG - Intronic
1162793311 19:13074050-13074072 TGGGGGGAGTGGAGAGAAGATGG - Intronic
1162830011 19:13278544-13278566 CCGGGGGTGTGGTGGGCAGAGGG - Intronic
1163207267 19:15812727-15812749 AGGGAGGAATGGAGGGAGGAAGG + Intergenic
1163422583 19:17222499-17222521 CGGGGGGAATGGAATGGGGAAGG + Intergenic
1163684728 19:18704931-18704953 GGGAGGGAATGGAGGGTAGTAGG - Intronic
1164004230 19:21134243-21134265 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1164202644 19:23031268-23031290 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1164258613 19:23550495-23550517 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1164588751 19:29494674-29494696 CGGGTGGTAAGGAGGGAAGAAGG + Intergenic
1164684526 19:30158127-30158149 CATGGGGAATGGGGGGCAGCAGG + Intergenic
1165282615 19:34810038-34810060 CGGGGGTGGTGGAGGGGAGAAGG - Intergenic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166347780 19:42177049-42177071 AGGGAGGAAGGGAGGGCAGGCGG + Intronic
1166543795 19:43622625-43622647 CGGGGGGCCTGGAGGAGAGATGG + Exonic
1166749019 19:45155975-45155997 TGGGGGCCATGGAGGGCAGATGG - Intronic
1166927300 19:46277806-46277828 AGGGAGGAATGGAGGGTGGAAGG + Intergenic
1166929973 19:46296635-46296657 GGGTGGGATTGGAGGTCAGAGGG + Intergenic
1167166522 19:47803131-47803153 CCTGGAGAATGGAGGGAAGAGGG + Intronic
1167269908 19:48500882-48500904 TGAGGGGTATGGAGGGCAAACGG + Intronic
1167290122 19:48619860-48619882 TGGGGGGAATGGAGGCCCAAAGG + Intronic
1168296664 19:55380340-55380362 AGGGGGGAAGGGAGGGGAGGGGG - Intronic
1168334831 19:55591837-55591859 AGGGGGGATTCGAGGGCAGGGGG + Exonic
1168642606 19:58040120-58040142 CGGGGGGCTTGGGGAGCAGAGGG + Intronic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
925203862 2:1990501-1990523 CGGGTGCCATGGAGGGCAGTGGG + Intronic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926191577 2:10732206-10732228 AGGGAGGGATGGAGGGAAGAAGG - Intronic
926419471 2:12682487-12682509 AGGGAGGAATGTAGGACAGAAGG + Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927168725 2:20350829-20350851 GGGGGGGAGGGGAGGGCAGGCGG - Intronic
927612671 2:24557540-24557562 AAGGGGGAAGGGAGGGGAGAAGG - Intronic
927693494 2:25224436-25224458 CGAGTGGAATGGAGGAGAGAGGG - Intergenic
928394910 2:30936165-30936187 TGGGGGGAATGGAGGGCGGGAGG - Intronic
928406949 2:31022181-31022203 GGGGAGGAAGGGAGGGAAGAAGG + Intronic
928615435 2:33034001-33034023 CTGGGGGACAGGAGAGCAGATGG + Intronic
928778151 2:34790961-34790983 AGGGAGGAATGGAGGGTGGAAGG - Intergenic
928903334 2:36344627-36344649 CGGAGGGGAGGGAGGGGAGAAGG + Intergenic
929342208 2:40834258-40834280 AGGGAGGAAGGGAGGACAGATGG - Intergenic
929626822 2:43417845-43417867 GGGGGGGAATGTTGGGCAGTAGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
931767501 2:65469909-65469931 GGGGAGGAAGGAAGGGCAGAGGG - Intergenic
931928021 2:67096369-67096391 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
932465590 2:71922153-71922175 TGGGGGGACTGGAGAGAAGAGGG - Intergenic
933127894 2:78634169-78634191 CGGGAGGAAGGGAGGGAAGAAGG + Intergenic
933374979 2:81467459-81467481 CGGGGCGTCTGCAGGGCAGAGGG + Intergenic
933663468 2:84946095-84946117 CGAGGGGAGGGGAGGGGAGAGGG + Intergenic
933708473 2:85308478-85308500 GGGGGGGAAGGGAGGGAAGGAGG - Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
935092150 2:99905429-99905451 CAAGAGGAAGGGAGGGCAGAGGG - Intronic
935282920 2:101534557-101534579 AGGGGGGTAGGGAGGGCAGGTGG + Intergenic
935549035 2:104432227-104432249 TGGGGGGAGTGGGGAGCAGAGGG - Intergenic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
935976877 2:108586909-108586931 AGGTGGGAGTGGAAGGCAGATGG - Intronic
935999363 2:108811143-108811165 AGGGGGGTAGGGAAGGCAGAGGG - Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937354181 2:121187741-121187763 AGGGGGAAATTGAGGGCAGAGGG - Intergenic
938306898 2:130262738-130262760 TGCAGGGAAAGGAGGGCAGAGGG - Intergenic
938642038 2:133291431-133291453 CGGGAGGAAAGGAGAGCAGAGGG + Intronic
938677065 2:133647546-133647568 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
939738492 2:145879260-145879282 AGGGAGGATGGGAGGGCAGATGG + Intergenic
939971817 2:148670714-148670736 CGAGGGGAAGGGAGGGGACAGGG - Intronic
940038989 2:149339736-149339758 AGGGGGGAATGCAGGACAGGAGG - Intronic
941114323 2:161454277-161454299 TGGGAGGGATGGAGGGAAGAAGG - Intronic
941565693 2:167103169-167103191 AGGAGGGAAGGGAGGGGAGAGGG + Intronic
942462449 2:176177913-176177935 CGAGGGGGATTGAGGGAAGATGG - Intergenic
943400906 2:187409894-187409916 GGAAAGGAATGGAGGGCAGAAGG + Intronic
943449978 2:188034467-188034489 AGGGAGGAATGGAGGGTGGAAGG - Intergenic
943835004 2:192507301-192507323 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
944486829 2:200215686-200215708 AGTGGGGAAGGGAGGGAAGAGGG - Intergenic
944657192 2:201887664-201887686 CTGGGAGAATGAAGGGCAGGAGG + Intronic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
945361502 2:208900487-208900509 AGGGAGGAATGGAGGGTGGAAGG - Intergenic
946146566 2:217735496-217735518 AGGGGAGAATGGCGGGCAGGAGG - Intronic
946432904 2:219635051-219635073 CTGGGGGAATGGAGGGCACCTGG + Intronic
946516736 2:220420032-220420054 CATGGGGAAGGGAGAGCAGAGGG + Intergenic
946519111 2:220446671-220446693 GGGGAGGAAGGGAGGGGAGAAGG - Intergenic
946785051 2:223234944-223234966 AGGGGGGAAAGGTGGGGAGAAGG - Intergenic
947077898 2:226364345-226364367 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
947128274 2:226894928-226894950 TGGGGGACATGGAGGGCAAAAGG + Intronic
947304876 2:228734467-228734489 TAGGGGGAATGGAGGGGAAATGG - Intergenic
947909151 2:233790371-233790393 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
949042848 2:241857516-241857538 CGGGGGAACCAGAGGGCAGAGGG - Intronic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
1168744072 20:221336-221358 GGGAGGGAATGGAGGGAAGGAGG + Intergenic
1168943478 20:1732565-1732587 AGGGAGGAATGGAGGGTGGATGG + Intergenic
1169303578 20:4468889-4468911 AGTGGGGAATGAAGGGCAGAGGG - Intergenic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1171035920 20:21712997-21713019 TGGAGGGAATGGAGGGCAGGAGG + Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171448853 20:25222506-25222528 GAGGGGGAATGTAGGGCAGATGG + Intronic
1172007433 20:31827014-31827036 TGGAGGGATGGGAGGGCAGAGGG - Intronic
1172241005 20:33412457-33412479 GTGGGGGAAGAGAGGGCAGAGGG + Intronic
1172579397 20:36034904-36034926 TGAGGGGAATGTAGGGCAGGGGG + Intergenic
1172829910 20:37824875-37824897 TGGGGAGAAGGAAGGGCAGAAGG + Intronic
1173687065 20:44931163-44931185 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
1174009946 20:47441754-47441776 GGAGGGGAAGGGAGGGAAGATGG - Intergenic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174236034 20:49092663-49092685 GCAGGGGAAGGGAGGGCAGAGGG + Intronic
1175252281 20:57616790-57616812 AGAGGGGAGTAGAGGGCAGAAGG + Intronic
1175292512 20:57886004-57886026 CGGGGGGAAGGGTGGGAGGAGGG - Intergenic
1175504282 20:59470735-59470757 CGTGGGGATTGGAGGCCAGAAGG - Intergenic
1175826948 20:61941695-61941717 CAGGAGGCACGGAGGGCAGAGGG - Intergenic
1175831575 20:61967637-61967659 AGGGGGGAACGGAGGGGAGGTGG - Intronic
1176077151 20:63253825-63253847 CGGGCGGAATGGGGGGCGGCGGG + Intronic
1176125428 20:63472748-63472770 GGAGGGGAAGGGAGGGGAGAGGG + Intergenic
1176156948 20:63626827-63626849 CGGGGGGAGGGGAGGGCCGGGGG - Intronic
1176243021 20:64083789-64083811 CGAGGGGGTCGGAGGGCAGAGGG - Intronic
1176550145 21:8217329-8217351 AGGGGGGAACGGGGGGCGGACGG - Intergenic
1176569073 21:8400364-8400386 AGGGGGGAACGGGGGGCGGACGG - Intergenic
1176576987 21:8444599-8444621 AGGGGGGAACGGGGGGCGGACGG - Intergenic
1176670362 21:9728391-9728413 GGGGGGGAATGGAGGGGGAAGGG + Intergenic
1177004746 21:15657609-15657631 TGGGGGGAATGGATGGAAGGGGG - Intergenic
1179457137 21:41507711-41507733 CGGGGGCCGTGGAGGGCAGGCGG + Intronic
1180748616 22:18109928-18109950 TGGGGGGAAGTGAGGGGAGATGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180782833 22:18530229-18530251 CGGGGCGAAAGGCGGGCAGGTGG - Intronic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181169107 22:20998343-20998365 CAGGGGCAAGGCAGGGCAGAAGG - Exonic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181239731 22:21469591-21469613 CGGGGCGAAAGGCGGGCAGGTGG - Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181487570 22:23241316-23241338 GGGGGGGAATGGCAGGAAGAGGG - Intronic
1181625714 22:24120895-24120917 CGGGGGGCATAGAGGGGTGAGGG + Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181961410 22:26624601-26624623 GGTGGGGAATGGGGGTCAGATGG + Intronic
1182114155 22:27745402-27745424 CTGGGGGAACGAGGGGCAGAAGG - Intergenic
1182166309 22:28177847-28177869 TTGGGGGAGTGGAGGACAGATGG + Intronic
1182356211 22:29723277-29723299 GGGGAGGCATGGAGGGCAGTTGG + Intronic
1182711857 22:32328170-32328192 ATGGGGGAACTGAGGGCAGAAGG - Intergenic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183646680 22:39131289-39131311 CTGGGGGAAAGAAAGGCAGATGG + Exonic
1183848479 22:40562754-40562776 AGGGGGGAATGGAGGGAGGGAGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184147370 22:42619428-42619450 GGCCGGGAATGGTGGGCAGACGG + Exonic
1184924195 22:47625930-47625952 GTGGGAGTATGGAGGGCAGAGGG - Intergenic
1185108780 22:48889340-48889362 CGGGGGCACTGGAGGGGAGAGGG - Intergenic
1185191229 22:49437862-49437884 GGGGAGGAATGGAGGGCTGCGGG - Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1203255038 22_KI270733v1_random:133661-133683 AGGGGGGAACGGGGGGCGGACGG - Intergenic
1203263094 22_KI270733v1_random:178740-178762 AGGGGGGAACGGGGGGCGGACGG - Intergenic
949516773 3:4814575-4814597 CGAGGGGAAGGAAGGGCAAAGGG + Intronic
949634449 3:5967585-5967607 AGGGAGGAAGGGAGGGAAGAAGG - Intergenic
950016989 3:9761358-9761380 GGGAAGGAAGGGAGGGCAGAGGG + Intronic
951762951 3:26164843-26164865 AGGGAGGAATGGAGGGTGGAAGG + Intergenic
952663604 3:35878801-35878823 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
952707060 3:36389970-36389992 GGGGGGGAAGGGAGTGCAGTGGG + Intronic
953279206 3:41536435-41536457 TGGGGGGTGTGGAGGGCAGTTGG - Intronic
953428730 3:42818995-42819017 TGGGGGAAATGGGGGGCAGGTGG + Intronic
953599582 3:44349458-44349480 AAGGAGGAATGGAGGGTAGAAGG + Intronic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
955592371 3:60551536-60551558 GGGGGGGAGGGGAGGGGAGACGG + Intronic
955674433 3:61434624-61434646 CGGGGCGGCTGGCGGGCAGAGGG + Intergenic
956644785 3:71444891-71444913 CATGGGGACTGGAGGGTAGAGGG + Intronic
956675229 3:71725904-71725926 AAGGAGGGATGGAGGGCAGATGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958971140 3:100611323-100611345 CGGGGGGAAGGAAGGGAGGAAGG - Intronic
959419195 3:106111458-106111480 CGGGGCGGCTGGCGGGCAGAGGG + Intergenic
959543854 3:107571123-107571145 AAGGGGGAATGGAGGGTGGAAGG + Intronic
960345980 3:116533638-116533660 TGGGGAGAAGGGAGGGGAGAGGG + Intronic
961063045 3:123848978-123849000 TGGTAGGAATTGAGGGCAGATGG + Intronic
961368818 3:126417536-126417558 CAGGGGGAATGGGGGTTAGACGG + Intronic
961511517 3:127406644-127406666 GTGGGGGAATGTTGGGCAGAGGG + Intergenic
961536140 3:127572208-127572230 AGGGGGGAATGGGGTGCCGAGGG - Intergenic
962203108 3:133415990-133416012 CGGGGTGAATAGAAGGGAGAGGG - Intronic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962437871 3:135383149-135383171 CAGGGAGAATGCAGGGCGGAAGG + Intergenic
962932157 3:140048700-140048722 TGGGGGGAGTGGGGGGCAGTGGG + Intronic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964587572 3:158324373-158324395 TGGGGTGAGGGGAGGGCAGAGGG - Intronic
965106569 3:164363058-164363080 CGAGTGGAGTGGAGGGCAGACGG + Intergenic
965615849 3:170591577-170591599 CGGGGTGATTGCAGGGGAGAGGG + Intronic
966397509 3:179518092-179518114 AGGGAGGAATGGAGGGTGGAAGG - Intergenic
966398596 3:179525390-179525412 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
967338207 3:188368014-188368036 TGTGGGGAAGGGAGGGCAGATGG - Intronic
968196741 3:196712783-196712805 CGGGAGGGAAGGAGGGCACACGG - Intronic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
968551529 4:1226055-1226077 GGTGGGGCATGGAGGGCGGAAGG - Intronic
968725200 4:2244133-2244155 GGGTGGGAATGCAGGGCTGAGGG + Intergenic
968943640 4:3652400-3652422 CGGAGGGGAAGGAGAGCAGAAGG - Intergenic
969036938 4:4262027-4262049 GGGTGGGGATGGAGGGCACAAGG - Intergenic
969293098 4:6253017-6253039 CGGGGGCAATGGTGAGCAAACGG + Intergenic
969465848 4:7355947-7355969 TGGAAGGAAGGGAGGGCAGAGGG - Intronic
970141644 4:12989332-12989354 CGGCGGGGATGGGGGGCAGGGGG + Intergenic
971727746 4:30335615-30335637 AGGGGGGAGTGGAGGGGGGAGGG + Intergenic
972055523 4:34797185-34797207 AGGGAGGGATGGAGGGAAGAAGG - Intergenic
973650477 4:52992861-52992883 CGGGGTGACTGCTGGGCAGAGGG - Intronic
973750975 4:54021058-54021080 AAGGGGGAATGGAGGGTGGAAGG - Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
975151923 4:71032458-71032480 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
976326634 4:83779247-83779269 TGGGGGGAAGGGAGGGGAAATGG - Intergenic
976390158 4:84498196-84498218 TGGGGGCAATGGAGGGCACCCGG - Exonic
976512534 4:85928311-85928333 CGGGAGGAAAGGAGGGAAGGAGG - Intronic
976744803 4:88392068-88392090 AGGGGGGAGTGGAGGGGAGAAGG - Intronic
976744822 4:88392112-88392134 AGAGGGGAAGGGAGGGGAGAGGG - Intronic
977062657 4:92275943-92275965 AAGGAGGAATGGAGGGCGGAAGG + Intergenic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
979054210 4:115976179-115976201 CGGGGGGAATGGAGAGATAATGG + Intergenic
979161292 4:117464638-117464660 TGGGGGGAGTGGGGGGCAGTGGG - Intergenic
980562983 4:134501956-134501978 CGGGGGGGAAGGGGGGCAGGCGG - Intergenic
980714225 4:136611162-136611184 AGGGAGGAATGGATGGCAGAAGG - Intergenic
980722525 4:136716914-136716936 TGCAGGGAAGGGAGGGCAGAGGG - Intergenic
980987557 4:139710535-139710557 CGGGGTGGAGGGAGGGCACAGGG - Intronic
981040110 4:140214826-140214848 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
981482867 4:145256000-145256022 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
981532214 4:145763843-145763865 GAGGGGGAGGGGAGGGCAGAAGG - Intronic
982318651 4:154057511-154057533 ATGGAGGAATGGAGGGCGGAAGG - Intergenic
984159127 4:176229916-176229938 GGGTGGGAGTGGAGAGCAGAAGG + Intronic
984822052 4:183890547-183890569 AGGGAGGAATGGAGGGAGGAAGG + Intronic
985034131 4:185821121-185821143 CGGGGGGCAAGGGGAGCAGAGGG + Intronic
985866676 5:2519552-2519574 AGGGAGGAGAGGAGGGCAGAGGG - Intergenic
985958055 5:3279026-3279048 AGGGAGGAAGGGAGGGAAGAGGG - Intergenic
986081102 5:4394991-4395013 CTAGGGGAGTGGAGTGCAGAAGG - Intergenic
986369129 5:7062755-7062777 AGGGAGGAATGGAGGGTGGAAGG + Intergenic
986445401 5:7816513-7816535 GGAGGGGAAAGGAGGGAAGAAGG + Intronic
986502439 5:8414982-8415004 AAGGAGGAATGGAAGGCAGAAGG - Intergenic
986587762 5:9336287-9336309 AAGTGGGAATGCAGGGCAGAAGG + Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987278025 5:16382922-16382944 CCGGGGTGATGGAAGGCAGAGGG - Intergenic
987574088 5:19703715-19703737 CGGGGGGCAGGGGGGGCAGGGGG - Intronic
988595337 5:32585693-32585715 CGAGAGGAGTGGAGGGCCGAAGG - Intronic
989069622 5:37497166-37497188 AGGGGGGAAGGGAGGGAAGGAGG - Intronic
989427405 5:41312647-41312669 AGGGAGGAAGGGAGGGAAGAAGG - Exonic
989615304 5:43332426-43332448 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
991265854 5:64716521-64716543 GGGGAGAAATGGAGGACAGAAGG + Intronic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
991622275 5:68557124-68557146 AGGGAGGAAAGGAGGGCAAAAGG + Intergenic
992452200 5:76885204-76885226 AAGGAGGAATGGAGGGTAGAAGG + Intronic
992487757 5:77211499-77211521 GGCGGGGAAGGGAGCGCAGAAGG + Intronic
993375066 5:87141102-87141124 AGGGAGGAAGGGAGGACAGAAGG + Intergenic
994049589 5:95347323-95347345 CAGGGGGAAAGGAGGCCAGGTGG + Intergenic
994074872 5:95639447-95639469 CTGGGGGACGGGTGGGCAGAAGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995769231 5:115651758-115651780 ATGGGGGAATGGAGGGCGGAAGG - Intergenic
996089327 5:119335623-119335645 TGGCTGGAAGGGAGGGCAGAAGG - Intronic
996389895 5:122948536-122948558 CGTGGGAAATTGAGGCCAGAGGG - Intronic
996575161 5:124971079-124971101 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
997157085 5:131572729-131572751 AGGGAGGAATGGATGGCGGAAGG - Intronic
997506602 5:134422766-134422788 TGGGGGGAAGGGAGAGGAGAAGG - Intergenic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997723987 5:136105016-136105038 CGGAGGGAATGGGGGTGAGAGGG + Intergenic
998708352 5:144791477-144791499 CCGGGGGAAGGGAAGGAAGAGGG - Intergenic
999530043 5:152452857-152452879 AGAGGGGAATGGGGGGCAGAAGG - Intergenic
999546440 5:152634051-152634073 TGTAGGGAACGGAGGGCAGAGGG - Intergenic
999758529 5:154682887-154682909 CGGGTGGAATGGAGGGAGGAGGG - Intergenic
1000075338 5:157779319-157779341 GGCGGGGAATGGAGGAGAGAGGG + Intergenic
1000984930 5:167855956-167855978 AGGAGGGAAGGGAGGGAAGAAGG + Intronic
1001331603 5:170766464-170766486 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002456141 5:179346104-179346126 CGGAGGGATGGGAAGGCAGATGG - Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002896726 6:1383989-1384011 TTGGGGGAAGGGAGGGCAGCGGG + Intergenic
1003516171 6:6820892-6820914 CAGGGGCAATGCAGGGGAGAGGG + Intergenic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1003891655 6:10569212-10569234 CGGGGGGAGTGGGTGGCAGGGGG - Intronic
1004562204 6:16761325-16761347 CGTGGGGAAGGGGGGGCAGAGGG + Exonic
1004653077 6:17630742-17630764 AGGGGAGAAGGGAGGGGAGAGGG + Intronic
1004695293 6:18027540-18027562 GGGGGGAAATGGAGGCAAGATGG - Intergenic
1004895253 6:20141799-20141821 CGGTGGGCATGAAGGGCAGCGGG + Intronic
1004986879 6:21092410-21092432 CGAGGGGAGTGGGGGGCAAAAGG - Intronic
1005014806 6:21365943-21365965 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1005786728 6:29251690-29251712 AAAGGGGAATGGAGGGCAGAAGG + Intergenic
1005957914 6:30677336-30677358 GGGGGGGAAGGGTGGGCAGAAGG - Intronic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006335937 6:33420478-33420500 AGGAGGGATTGGAGGCCAGAGGG + Intronic
1006385133 6:33726614-33726636 CGGGGCCAATGGAGGGTAGCAGG - Intronic
1006447695 6:34089046-34089068 ATGGGGAAATGGAGGCCAGAGGG - Intronic
1006727620 6:36211231-36211253 CAGGGAGAAGGGAGGACAGAAGG - Intronic
1007555460 6:42762036-42762058 CGTGGTGACTGGAAGGCAGAAGG - Intronic
1007732320 6:43954692-43954714 GGGGGAGGGTGGAGGGCAGAGGG - Intergenic
1008362335 6:50635541-50635563 AGGGGAGAAGGGAGGGGAGAAGG + Intergenic
1008713179 6:54254768-54254790 GGGGGGGAAGGGAGGGAGGAAGG - Intronic
1009826701 6:68875236-68875258 GGAGGGGAGGGGAGGGCAGAGGG - Intronic
1010615502 6:78007080-78007102 CGGGGAGAATGGAAGGAAGTTGG + Intergenic
1011632321 6:89339516-89339538 AGGGGGGAAGGGAGGGAAGTGGG + Intronic
1012398378 6:98824951-98824973 CGGGGGGAATGCGGGGCGGGGGG - Intergenic
1012475793 6:99613802-99613824 CCGGGGGGACGGAGAGCAGAGGG - Exonic
1013971605 6:116026525-116026547 AGGGGGGAAGGGAGGAAAGAAGG + Intronic
1014555697 6:122841098-122841120 GAGGAGGAATGGAGGGTAGAAGG - Intergenic
1014611926 6:123557875-123557897 AGGGAGGAATGGAGGGTGGAAGG - Intronic
1014677013 6:124379207-124379229 GGGAGGGAAAGGAGGGAAGAGGG + Intronic
1014794138 6:125706313-125706335 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1015181242 6:130365312-130365334 CGGGGGAAATGGAAGACAGAGGG - Intronic
1015181618 6:130366605-130366627 GGAGGGGAGGGGAGGGCAGAGGG - Intronic
1015801523 6:137065804-137065826 AGGGAGGAATGGAGGGTGGAAGG + Intergenic
1015843655 6:137496905-137496927 CGGGGGGAGGGGAGGGAAGGAGG + Intergenic
1015883730 6:137895066-137895088 CTGGGAGAATGCACGGCAGAAGG - Intergenic
1016403269 6:143703226-143703248 CTGGGGGAATAGAGGTGAGAGGG + Intronic
1016873658 6:148843135-148843157 CAGGGGGAATGGGAAGCAGATGG + Intronic
1017770375 6:157639669-157639691 CGGGGGAAATCGGTGGCAGAGGG + Intronic
1018429849 6:163713937-163713959 TGTGGGGATGGGAGGGCAGAGGG + Intergenic
1018840637 6:167514186-167514208 CTGGGGGAATGGAGGCCTGGCGG + Intergenic
1019013475 6:168861771-168861793 GGAGGGGACTCGAGGGCAGAAGG + Intergenic
1019405841 7:883701-883723 CGGGGAGAGTGGGGGGCAGCTGG - Intronic
1019563058 7:1667391-1667413 CGGGGGTTGTGGAGGGCAGGGGG + Intergenic
1019573622 7:1725450-1725472 CGGGAGGGAGGGAGGGCAGCAGG + Intronic
1019575621 7:1736288-1736310 CAGGGGGAAAGGTGGGCGGAGGG - Intronic
1019686737 7:2386046-2386068 CAGGGGGAGTGGACTGCAGAGGG + Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019781673 7:2944060-2944082 GTGGGGGAATGGAGGACACAGGG - Intronic
1020121576 7:5507002-5507024 CGGGGACAAAGGAAGGCAGAAGG + Intronic
1020541274 7:9462967-9462989 AAGGAGGAATGGAGGGCGGAAGG + Intergenic
1021174667 7:17437428-17437450 GTGGGGAATTGGAGGGCAGAAGG + Intergenic
1021296832 7:18918333-18918355 TGGGGGGGATGGAGGGGAAAGGG + Intronic
1021852392 7:24821431-24821453 GGGGAGGAAGGGAGGGCAGTGGG + Intronic
1021866375 7:24962388-24962410 AGGGGGGAGGGGAGGGCAGAAGG + Intronic
1022021611 7:26404949-26404971 CAGGGAGAAAGGAGAGCAGAAGG + Intergenic
1022332302 7:29391359-29391381 GGAGGGGAAGGGAGGGTAGAAGG + Intronic
1022447258 7:30480499-30480521 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1022465791 7:30652628-30652650 AGGGGAGACTGGAGGGCAAAGGG + Intronic
1022710194 7:32842339-32842361 AGGGAGGAATGGAGGGTGGAAGG + Intergenic
1023009916 7:35917472-35917494 GGAGGGGAAAGGAGGGGAGAAGG - Intergenic
1023062661 7:36343413-36343435 TGGGGGGAGAGGAGGGGAGATGG + Intronic
1023699373 7:42877616-42877638 GAGGGGGACTGGTGGGCAGAGGG - Intergenic
1023921890 7:44636252-44636274 CTGGGGGAAGGGATGTCAGATGG + Intronic
1024804147 7:53116775-53116797 CTGGGGGAGAGGAGGGCATATGG + Intergenic
1025071532 7:55903781-55903803 GGGGGTGGATGGAGGGCACATGG + Intronic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026828862 7:73599797-73599819 CATGGGGACTGGCGGGCAGAGGG + Intronic
1026928439 7:74209893-74209915 TGGGGGGAAGGGAGGGGAGACGG - Exonic
1027261507 7:76468057-76468079 CGGGGGGAATGGAGAGAGGAGGG + Intronic
1027312888 7:76966166-76966188 CGGGCGGAATGGAGAGAGGAGGG + Intergenic
1027354263 7:77340924-77340946 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1028104775 7:86864170-86864192 CGGGGGGAAGGGTGGGAAGGAGG - Intronic
1028659560 7:93253721-93253743 CAGGTGGCATGGAGGGCAGTGGG + Intronic
1028748002 7:94349375-94349397 CGGGGGGTAGGGTGGGTAGAGGG + Intergenic
1029055132 7:97733149-97733171 CAGGGGGATTGGAGGGCCGGAGG + Intronic
1029201430 7:98841863-98841885 CGGGGGGCATGGCGGGCAGAGGG - Intergenic
1029364393 7:100107653-100107675 TGGGGGGCAGGGAGGGCACAGGG - Intronic
1029438608 7:100575547-100575569 CAGGGGGCATGCAGGGCAGGGGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029953598 7:104613602-104613624 AGGGGTGAGTGGAGGGTAGATGG - Intronic
1030384078 7:108847446-108847468 GGAGGGGAATGGAGGGGAGGAGG - Intergenic
1030716722 7:112816262-112816284 TGGGGGGAGGGGAGGGCAGTGGG - Intergenic
1030730809 7:112986276-112986298 AGTGGGAAATGGAGGGGAGAAGG + Intergenic
1031122885 7:117741203-117741225 ATGGGGGAATGGAGAGCAGGAGG + Intronic
1032201366 7:129825328-129825350 CGGGGGGCAGGGTGGGAAGAGGG - Intergenic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032425069 7:131815969-131815991 CCTGGGGAATAGAGGGCAGAGGG - Intergenic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1034251102 7:149691386-149691408 CTAGGGGAAATGAGGGCAGAAGG - Intergenic
1034605330 7:152307383-152307405 AGGGAGGAAGGGAGGGGAGAAGG + Intronic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035166887 7:156996044-156996066 GGAGGGGAATGGAGGGGAGGGGG - Intronic
1035401811 7:158570561-158570583 CGGGGGGCACGGAGGACACAGGG - Intronic
1035880818 8:3242678-3242700 AGAGGGGAATGGAGGGCGGAAGG + Intronic
1036472491 8:9063909-9063931 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1036810997 8:11867738-11867760 GGAGGGGAGCGGAGGGCAGAGGG + Intronic
1037806458 8:22060244-22060266 CGGGGTGCATGGATGGGAGAGGG + Intronic
1038642007 8:29336634-29336656 GGGGAGGAAGGGAGGGCAAAGGG - Exonic
1039314572 8:36356945-36356967 CTGGGGGAATGGAAAGCAGCAGG + Intergenic
1039419045 8:37420352-37420374 CGGGGGGACTGCGGGGCATATGG - Intergenic
1039454346 8:37697491-37697513 CGGGGGAAAGGGCGGGCAGGCGG - Exonic
1039499149 8:38003160-38003182 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1041753561 8:61288261-61288283 CGGGAGGGATGGAGTGCAGAGGG - Intronic
1042212505 8:66394887-66394909 CTGGTGTGATGGAGGGCAGAAGG + Intergenic
1042528489 8:69791029-69791051 AGGGAGGAATGGAGGGAGGAGGG + Intronic
1042705935 8:71665633-71665655 AGGGAGGAATGGAGGGTAGAAGG - Intergenic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043322698 8:79009472-79009494 AGGGAGGGATGGAGGGCAGGAGG - Intergenic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1044119955 8:88382484-88382506 AGGGAGGAAGGGAGGGAAGAGGG - Intergenic
1044119962 8:88382503-88382525 GGAGGGAAATGGAGGGAAGAGGG - Intergenic
1044195241 8:89368206-89368228 TTGGTGGAATGGAGGGCTGATGG + Intergenic
1044591769 8:93919482-93919504 GGGGGGGGAGGGAGGGCAGCGGG - Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045718315 8:105074893-105074915 CGGGAGGGAGGGAGGGAAGAAGG - Intronic
1046064255 8:109177618-109177640 GTGGGGGAATGGAGGGCATCAGG - Intergenic
1046320189 8:112564326-112564348 AGGGGAGAAGGGAGGGGAGAAGG - Intronic
1046320194 8:112564338-112564360 AGGGGAGAAAGGAGGGGAGAAGG - Intronic
1046457853 8:114491181-114491203 GGAGGGGAAAGGAGGGCAGGAGG + Intergenic
1047687611 8:127317222-127317244 CGGGGCGGCTGGCGGGCAGAGGG - Intergenic
1048339053 8:133524989-133525011 CGTGGTGAATGGAGGGAGGAGGG + Intronic
1048975964 8:139673195-139673217 TGGGGGGAATGGAGGGCCGGGGG + Intronic
1049014103 8:139907505-139907527 TGGGGGGAAGGGAGAGGAGAGGG + Intronic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049393304 8:142382978-142383000 TGGGGGGAAAGGAGGGCAGGGGG + Intronic
1049400965 8:142427056-142427078 CTGGAGGAATGGAGGCCACATGG - Intergenic
1049440502 8:142607323-142607345 GGAGGGGAGTGGAGGGCAGGGGG + Intergenic
1049463559 8:142740974-142740996 CGTGGGGTATGGAAGGCAGAGGG + Exonic
1049488030 8:142876585-142876607 AGTGGGGAATGGAGGCCACAGGG - Intronic
1049492919 8:142914608-142914630 AGTGGGGAATGGAGGCCACAGGG - Intronic
1049578808 8:143401557-143401579 GGAGGGGAAGGGAGGGCAGAGGG + Intergenic
1049578822 8:143401584-143401606 GGAGGGGAGGGGAGGGCAGAGGG + Intergenic
1049700102 8:144006958-144006980 AGGGTGGAATGGAGAGCAGGTGG - Intronic
1049712382 8:144071208-144071230 AGGGGGGAGGGGAGGGGAGAGGG - Intergenic
1049737708 8:144218698-144218720 AGGGGGGACAGGAGGGGAGAGGG - Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1052982057 9:34457357-34457379 CGGAGGGAATGGAAGGGGGAGGG - Intronic
1053060119 9:35024099-35024121 AAGGGGGAATGGAGGGCGGAAGG + Intergenic
1053148514 9:35728142-35728164 GGGGGGGAATGGAGGACAGGAGG + Intronic
1053333164 9:37235513-37235535 GGAGGGGAAGGGAGGGGAGAGGG - Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1055611544 9:78030730-78030752 GGGGTGGAAAGGTGGGCAGAGGG - Intronic
1056101307 9:83302875-83302897 CGGGTGGAAAGGAAGGCAGAAGG - Intronic
1056391725 9:86147034-86147056 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1056601527 9:88050754-88050776 GGAGGGGAATGGAGGTGAGAAGG - Intergenic
1056805792 9:89727616-89727638 AGGGGGGTGTGGAGGGGAGATGG + Intergenic
1057040954 9:91847073-91847095 CGGGGGGAAATGGGGGAAGATGG + Intronic
1057293973 9:93824804-93824826 CTGGGGGAAGGGAGGGCACTCGG - Intergenic
1057458132 9:95233117-95233139 AGGCGGGAAAGGAGGGGAGATGG + Intronic
1059268940 9:113060602-113060624 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059270076 9:113066051-113066073 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059271210 9:113071499-113071521 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059272343 9:113076945-113076967 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059273478 9:113082387-113082409 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059274614 9:113087833-113087855 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059354243 9:113687113-113687135 GGTGGGGAAGGGAGGGAAGAGGG + Intergenic
1059354307 9:113687345-113687367 GGTGGGGAAAGGAGGGAAGAGGG + Intergenic
1059542500 9:115144314-115144336 GGAGGGGAGTGGAGGGGAGAAGG - Intronic
1059803498 9:117774032-117774054 AGGGGAGAAGGGAGGGGAGAAGG - Intergenic
1059878352 9:118661039-118661061 AGGAGGGAAGGGAGGGCAGGAGG + Intergenic
1059994085 9:119892547-119892569 TGGGGGGAAGGGAGGAAAGAAGG + Intergenic
1060341425 9:122780107-122780129 CGAAGGGAATGGAAGGGAGAAGG - Intergenic
1060851052 9:126876183-126876205 GGGGGGGAAAGGAGGGAAGGGGG - Intronic
1061226076 9:129281695-129281717 CGCTGGGAGTGGAGGGCTGAGGG + Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061808172 9:133148039-133148061 CGGGGGGGCTGAAGGGCTGAGGG - Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062326812 9:136016493-136016515 CAGGGAGCATGGAGGGCAGGCGG - Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1203792867 EBV:160940-160962 CGGGGAGAACGGTGGCCAGACGG + Intergenic
1203471438 Un_GL000220v1:116801-116823 AGGGGGGAACGGGGGGCGGACGG - Intergenic
1203479259 Un_GL000220v1:160773-160795 AGGGGGGAACGGGGGGCGGACGG - Intergenic
1185506383 X:634592-634614 CGTGGGGAGCGGAGGGCACAGGG - Intronic
1185537324 X:872826-872848 GGAGGGGAAGGGAGGGGAGAGGG - Intergenic
1185700518 X:2227774-2227796 AGGGGGGAAGGGAGGGGGGAAGG + Intronic
1186486058 X:9935238-9935260 GGGGGTGAAGGGAGTGCAGAGGG + Intronic
1186526736 X:10255667-10255689 AGGGGGAAATAGGGGGCAGAGGG + Intergenic
1188333176 X:28897075-28897097 AGGGAGGAATGGAGGGTGGAAGG + Intronic
1188430873 X:30104600-30104622 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188586710 X:31785599-31785621 TTGGGGGATTGGGGGGCAGAGGG - Intronic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1189031974 X:37460285-37460307 AGGGAGGAATGGAGGGTGGAAGG + Intronic
1189321503 X:40090260-40090282 CGGGAGGGACGGAGGGGAGACGG + Intronic
1189473660 X:41333335-41333357 GGGGGGAAATGGAGGGGAGCCGG - Intronic
1189733455 X:44045878-44045900 CGGGGGAAAGGGTGGGAAGAGGG - Intergenic
1189760923 X:44320789-44320811 AGGAGTGAATGGAGGGGAGAAGG - Intronic
1190595808 X:52052011-52052033 CATGGGAAATGGAGGGCAGCTGG + Exonic
1190613016 X:52202062-52202084 CATGGGAAATGGAGGGCAGCTGG - Exonic
1190659701 X:52643085-52643107 TGTGGGGAAGGAAGGGCAGAGGG - Intergenic
1190663826 X:52679338-52679360 TGTGGGGAAGGAAGGGCAGAGGG + Intronic
1190675597 X:52779084-52779106 TGTGGGGAAGGAAGGGCAGAGGG - Intronic
1191805962 X:65134117-65134139 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1192246156 X:69373348-69373370 TGGGGAGAATGGAGTGGAGAAGG - Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1192547800 X:72028024-72028046 CTAGAGGAATGGAGGCCAGAGGG + Intergenic
1195202525 X:102564691-102564713 AGGCGGGAGTGGAAGGCAGAGGG + Intergenic
1196090253 X:111733284-111733306 CGGGGGAAATGGTGGGAAGGGGG - Intronic
1196210098 X:112986421-112986443 GGAGGGGAAGGGAGGGAAGAGGG + Intergenic
1196237554 X:113299998-113300020 AGGGGAGAAGGGAGGGGAGACGG - Intergenic
1196469703 X:116011566-116011588 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
1197470811 X:126864352-126864374 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1197783622 X:130179545-130179567 CAGGAGGAATGGAGGTCAGTAGG - Intronic
1198160560 X:134003703-134003725 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
1198311141 X:135426374-135426396 GGCGGGGGAGGGAGGGCAGAGGG + Intergenic
1198421367 X:136473074-136473096 AGGGAGGAATGAAGGGAAGAAGG + Intergenic
1198421381 X:136473119-136473141 AGGGAGGAATGAAGGGAAGAAGG + Intergenic
1198683453 X:139204788-139204810 CGCGGGGAATGGGGAGGAGAGGG + Intronic
1200101069 X:153689267-153689289 CGAGGGGAGGGGAGGGCAGGGGG - Intronic