ID: 903353598

View in Genome Browser
Species Human (GRCh38)
Location 1:22732766-22732788
Sequence CAGGAACGCAGGAGGAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 347}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903353598_903353609 15 Left 903353598 1:22732766-22732788 CCATTGCTCCTCCTGCGTTCCTG 0: 1
1: 0
2: 3
3: 41
4: 347
Right 903353609 1:22732804-22732826 ATGACCCATCACTTAGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903353598 Original CRISPR CAGGAACGCAGGAGGAGCAA TGG (reversed) Intronic