ID: 903353604

View in Genome Browser
Species Human (GRCh38)
Location 1:22732774-22732796
Sequence CCCCCGCCCAGGAACGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903353604_903353609 7 Left 903353604 1:22732774-22732796 CCTCCTGCGTTCCTGGGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 184
Right 903353609 1:22732804-22732826 ATGACCCATCACTTAGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903353604 Original CRISPR CCCCCGCCCAGGAACGCAGG AGG (reversed) Intronic