ID: 903353604 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:22732774-22732796 |
Sequence | CCCCCGCCCAGGAACGCAGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 198 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 184} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
903353604_903353609 | 7 | Left | 903353604 | 1:22732774-22732796 | CCTCCTGCGTTCCTGGGCGGGGG | 0: 1 1: 0 2: 0 3: 13 4: 184 |
||
Right | 903353609 | 1:22732804-22732826 | ATGACCCATCACTTAGAGATAGG | 0: 1 1: 0 2: 0 3: 6 4: 95 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
903353604 | Original CRISPR | CCCCCGCCCAGGAACGCAGG AGG (reversed) | Intronic | ||