ID: 903353606

View in Genome Browser
Species Human (GRCh38)
Location 1:22732777-22732799
Sequence ACACCCCCGCCCAGGAACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903353606_903353609 4 Left 903353606 1:22732777-22732799 CCTGCGTTCCTGGGCGGGGGTGT 0: 1
1: 0
2: 2
3: 6
4: 121
Right 903353609 1:22732804-22732826 ATGACCCATCACTTAGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903353606 Original CRISPR ACACCCCCGCCCAGGAACGC AGG (reversed) Intronic