ID: 903353606 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:22732777-22732799 |
| Sequence | ACACCCCCGCCCAGGAACGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 130 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 6, 4: 121} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 903353606_903353609 | 4 | Left | 903353606 | 1:22732777-22732799 | CCTGCGTTCCTGGGCGGGGGTGT | 0: 1 1: 0 2: 2 3: 6 4: 121 |
||
| Right | 903353609 | 1:22732804-22732826 | ATGACCCATCACTTAGAGATAGG | 0: 1 1: 0 2: 0 3: 6 4: 95 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 903353606 | Original CRISPR | ACACCCCCGCCCAGGAACGC AGG (reversed) | Intronic | ||