ID: 903353609

View in Genome Browser
Species Human (GRCh38)
Location 1:22732804-22732826
Sequence ATGACCCATCACTTAGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903353606_903353609 4 Left 903353606 1:22732777-22732799 CCTGCGTTCCTGGGCGGGGGTGT 0: 1
1: 0
2: 2
3: 6
4: 121
Right 903353609 1:22732804-22732826 ATGACCCATCACTTAGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 95
903353604_903353609 7 Left 903353604 1:22732774-22732796 CCTCCTGCGTTCCTGGGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 184
Right 903353609 1:22732804-22732826 ATGACCCATCACTTAGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 95
903353598_903353609 15 Left 903353598 1:22732766-22732788 CCATTGCTCCTCCTGCGTTCCTG 0: 1
1: 0
2: 3
3: 41
4: 347
Right 903353609 1:22732804-22732826 ATGACCCATCACTTAGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 95
903353607_903353609 -4 Left 903353607 1:22732785-22732807 CCTGGGCGGGGGTGTCACCATGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 903353609 1:22732804-22732826 ATGACCCATCACTTAGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903353609 Original CRISPR ATGACCCATCACTTAGAGAT AGG Intronic