ID: 903355633

View in Genome Browser
Species Human (GRCh38)
Location 1:22745660-22745682
Sequence CTCTGAAAGGGGGTGGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903355625_903355633 3 Left 903355625 1:22745634-22745656 CCTGTCTGAGCCTCAGTTTCCTT 0: 4
1: 123
2: 1026
3: 3729
4: 8271
Right 903355633 1:22745660-22745682 CTCTGAAAGGGGGTGGTCACAGG 0: 1
1: 0
2: 0
3: 14
4: 147
903355626_903355633 -7 Left 903355626 1:22745644-22745666 CCTCAGTTTCCTTTATCTCTGAA 0: 1
1: 3
2: 9
3: 77
4: 556
Right 903355633 1:22745660-22745682 CTCTGAAAGGGGGTGGTCACAGG 0: 1
1: 0
2: 0
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903355633 Original CRISPR CTCTGAAAGGGGGTGGTCAC AGG Intronic
900637223 1:3671863-3671885 CGCTGCACGGGGGAGGTCACGGG + Intronic
901107778 1:6770740-6770762 CTCTGAATCTGGGTGGTCTCCGG - Intergenic
901842585 1:11963511-11963533 CTCTGCAAGGAGGAGGACACAGG - Exonic
902375820 1:16029485-16029507 CTTTAAAATGGGGTGGTTACTGG + Intronic
902395901 1:16132438-16132460 GTCTGTAGGGGGGTGGGCACAGG + Exonic
902631743 1:17708785-17708807 CTCTGTAAGATGGTGGTAACAGG + Intergenic
903355633 1:22745660-22745682 CTCTGAAAGGGGGTGGTCACAGG + Intronic
903853025 1:26319621-26319643 CTGTGAAAGGGGGTGGACAGGGG + Intronic
905179734 1:36158015-36158037 GCCTGAATGGGGGTGGTGACTGG + Intronic
905227568 1:36489165-36489187 CTCTGAGAGGGGGTTGTGGCAGG + Intergenic
906291937 1:44625163-44625185 CTCAGAAAGGAGGTGCTCTCAGG - Intronic
907159156 1:52358640-52358662 CTCTGTGAGGAGGTGGTCCCTGG - Intronic
908495154 1:64687610-64687632 CTCTGAACCTGGCTGGTCACAGG - Intronic
915015228 1:152726757-152726779 CTCTGAGACAGGGTGGTCAGAGG - Intergenic
920347118 1:205313637-205313659 CTCTGAGAAGGGGTGGGGACTGG - Intronic
920938282 1:210456430-210456452 CTCAAAAAGGGGGTGGTCCCAGG - Intronic
922731178 1:227949420-227949442 CTCAGAAAGGGTATGCTCACAGG - Intergenic
922853701 1:228756003-228756025 CTCAGGAAGGGGGTTGTGACAGG + Intergenic
922911537 1:229221804-229221826 CACGGAAGGGGGGTGGTAACGGG + Intergenic
1065388671 10:25159405-25159427 CTCTGAGAGAAGGAGGTCACAGG - Intergenic
1068117469 10:52750743-52750765 CTCTGAAAGGGGCTGGACTCAGG + Intergenic
1070783813 10:79151780-79151802 CTCTGAATGGGAGTGGACTCTGG + Intronic
1072127425 10:92459468-92459490 CTCTAAAAGGATGTGGGCACAGG + Intronic
1072252913 10:93595775-93595797 CTCTGCAGGGGGGCTGTCACAGG + Intronic
1073056509 10:100706739-100706761 CTCAGAAAGAGGGGTGTCACTGG + Intergenic
1074517322 10:114182195-114182217 TTTTGAAAGGTTGTGGTCACAGG + Intronic
1075334087 10:121596742-121596764 CCCTGAAAGGGGGTGGTGGTGGG - Intronic
1075903465 10:126061973-126061995 CTCCCAAAGGAGGTGGTCAAAGG + Intronic
1076055433 10:127368489-127368511 CTCTGGATTGGGGTGGGCACAGG - Intronic
1076059111 10:127399814-127399836 CTCAGAGAGGAAGTGGTCACTGG + Intronic
1077439827 11:2562617-2562639 CTCTGAAGAGGGGTGGACACAGG - Intronic
1079569223 11:21921979-21922001 CTCTGAAAGGAGCAGGCCACAGG - Intergenic
1080571305 11:33559484-33559506 CTGTGAAAGGGCGTCATCACTGG + Intronic
1081114666 11:39185101-39185123 CTCTGAAAGGGGGATGAAACAGG + Intergenic
1081658776 11:44875084-44875106 CTCTGCAAGGGGCTGGTCCAAGG - Intronic
1083947305 11:65931374-65931396 CTCTGAATGGTGGTGGGCCCAGG + Intergenic
1085284308 11:75350220-75350242 CCCTGAAAGGTGGTGCCCACCGG + Intronic
1087778300 11:102276966-102276988 CTCTAAAAGTGGGTTGTGACAGG - Intergenic
1089401039 11:118164927-118164949 CTAGGAAAGGGGGTGGAGACAGG - Exonic
1089649353 11:119902234-119902256 CTGTGACATGGGGTGGCCACAGG - Intergenic
1091998718 12:5016136-5016158 CTTTAATAGGGGGCGGTCACAGG + Intergenic
1092174099 12:6391074-6391096 CTCTGAGAGCAGGTGGGCACTGG + Exonic
1094446018 12:30531361-30531383 TTTGGAAAGGGGGTGGTCTCTGG + Intergenic
1096217056 12:49803606-49803628 CTAGGAAAGGGGGTGGTCAGAGG - Intronic
1096842052 12:54385650-54385672 GTATGAAAGGGGGTGGTGTCTGG - Intronic
1097925134 12:65118937-65118959 ATCTGAAAGGGTTTGGTAACTGG - Intronic
1102009969 12:109612173-109612195 CTGTCAAATGGGGTGGTAACAGG + Intergenic
1102062963 12:109948375-109948397 CTCTAAAATGGGGTGGTGCCAGG - Intronic
1115313866 14:32006300-32006322 CTCTGGAAGGGGGTGGGCGGAGG - Intergenic
1116013798 14:39382239-39382261 CTCTGGAAGGGAGAGCTCACAGG + Intronic
1117449522 14:55837356-55837378 CTCTGAATGGGGGTCTTCAAGGG + Intergenic
1119826572 14:77661592-77661614 CTCGGAGAGGGGGAGGTGACAGG + Intergenic
1121034079 14:90684710-90684732 CCCTGGATGGGGGTGGTGACTGG + Intronic
1121581533 14:95035787-95035809 CTCTGACAGAGGGTGTTCGCTGG - Intergenic
1122439139 14:101718283-101718305 CTTAGAGAGGGGGTGGTCTCTGG - Intergenic
1123116208 14:105895214-105895236 CTCTGACATGGGGTGCTCTCAGG + Intergenic
1131468251 15:92673016-92673038 CCCTGAAAGGGGCTTGTCTCAGG - Intronic
1132401315 15:101507592-101507614 CGCTGAAAGGTGGTGGTCTCTGG - Intronic
1134095130 16:11414014-11414036 CTTTGAAGGGGGCTGGGCACAGG + Intronic
1148343549 17:46888486-46888508 CTCTGAAAGGCCTTGGTGACAGG + Intergenic
1151666471 17:75548054-75548076 CACTGAAAGGGAATGCTCACTGG + Intronic
1155021178 18:21898256-21898278 CTTTGAAAGGAGGTGGTGGCAGG - Intergenic
1155637910 18:27976893-27976915 GGCTGAAAGGGGATGGTCCCAGG + Intronic
1157169921 18:45393773-45393795 CTCTGAAAAGGGTAAGTCACTGG - Intronic
1158316894 18:56221269-56221291 CTCTGAAAGAGAGTGGTCTCTGG - Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1162438930 19:10680803-10680825 TTTGGAAGGGGGGTGGTCACAGG + Intronic
1165761999 19:38326967-38326989 CTCTACAAGGTGCTGGTCACAGG + Exonic
1165782105 19:38440949-38440971 GTCTGAAAGGAGGTGCTGACAGG + Intronic
1165897984 19:39154919-39154941 CTGTGACAGGGGGTGGACAGAGG + Intronic
1166020517 19:40024642-40024664 CTCTGAAAGGGGCTGAGAACAGG + Intergenic
1166059084 19:40313681-40313703 TTCTAAAAGGGAGTTGTCACTGG + Intergenic
1167052123 19:47085656-47085678 CTCTAAAAGGGAGTGGGCAGTGG + Intronic
926894191 2:17666737-17666759 CTTTGAGAGGTGGAGGTCACAGG + Intronic
928109609 2:28495959-28495981 CTTTGAAAGGGGGTAGTGGCGGG - Intronic
929967345 2:46545096-46545118 TGGTGAAAGGGGGTGGTCTCAGG - Intronic
931044425 2:58334458-58334480 CTCAGGAAGGGGGTGGTCTGAGG + Intergenic
932124926 2:69136232-69136254 CTGTGAATGGGGGTGGGCAGTGG - Intronic
933301579 2:80546825-80546847 CTCTGTGAGGAGGAGGTCACTGG + Intronic
936049617 2:109213202-109213224 CTCTGGAAGTAGGTGGTCCCAGG + Intronic
936264545 2:110992686-110992708 CTTTGAAAGGGGGTTGTACCTGG + Intronic
938093891 2:128449439-128449461 CTCTGACTGTGGGTGGTGACTGG + Intergenic
938406199 2:131034695-131034717 CTCTGAAACGAGGAGGTCCCGGG + Intronic
939568031 2:143807911-143807933 TTGTGAAAGGGGGTGGGCTCTGG - Intergenic
940852190 2:158699062-158699084 CTCTGAAAGGTAGTGGTGAAGGG - Intergenic
943699308 2:190972495-190972517 CTCTGAAAGAGGGTGGTACCAGG - Intronic
944036111 2:195296610-195296632 CTTTGGAAAGGTGTGGTCACTGG - Intergenic
944873681 2:203939815-203939837 CTCTGGAAGGGGGTGCTGTCAGG - Intronic
945884725 2:215363111-215363133 TTCTGTAAGGAGGTAGTCACTGG - Intronic
947840085 2:233202178-233202200 CCCTGAGAGAGGGTGGTCAGAGG + Intronic
948834440 2:240619413-240619435 CTCTGAAGGCTGGTGGTCCCAGG + Intronic
1172720612 20:36997939-36997961 CTCTGAATGGCGGTGGTACCTGG + Exonic
1176263505 20:64196084-64196106 CTCTCAAGGGGAGAGGTCACCGG + Intronic
1180096157 21:45556022-45556044 CTCTGAAGGTCGGAGGTCACAGG + Intergenic
950168783 3:10821968-10821990 TTCTGAAAGGAGGTGGTCTGGGG - Intronic
950609493 3:14116885-14116907 CTCTGAAAGGCTGAGGACACAGG + Intronic
950900703 3:16494891-16494913 CTCTAAAAGGAAGCGGTCACTGG - Intronic
950923232 3:16716068-16716090 CTCTGATAGGGGGTGGCTAGAGG + Intergenic
953018163 3:39097851-39097873 ACTTGAAAGGGGGTGGTCCCAGG + Exonic
955745477 3:62136045-62136067 CTCTGAAAGGGGGATCTCAGGGG + Intronic
956005008 3:64769486-64769508 CCCTGAAAGGAGGAGGTCCCTGG - Intergenic
961871645 3:129992850-129992872 CTCTGACAGGGGCTGGGCAGGGG + Intergenic
962555103 3:136541177-136541199 CTTTGACAGGGAGTGGGCACGGG - Intronic
965810279 3:172584624-172584646 CTCAGAAAGCGGGTTCTCACTGG + Intergenic
969351495 4:6600557-6600579 TTCTGGAATGGGGTGCTCACTGG - Intronic
969612906 4:8237000-8237022 CCCTGAAAAGGGGAGGACACCGG + Intronic
972712446 4:41610967-41610989 CTCTGAAAGGAAGTGCTCACTGG + Intronic
982472716 4:155812589-155812611 CTCTGAAGAGGGGGGGTCAGGGG + Intergenic
982719853 4:158848222-158848244 GTCTCAATGGTGGTGGTCACAGG + Intronic
985816519 5:2131991-2132013 CTTGGAAAGGGGGGCGTCACCGG - Intergenic
985828163 5:2208040-2208062 CTCTGAAAGGGAGTGGGGAGAGG - Intergenic
987999880 5:25334511-25334533 GTCTGAAAGGGTGTTGTCAAAGG + Intergenic
988533158 5:32042735-32042757 GGCTGGAAGGGGCTGGTCACCGG - Intronic
989196602 5:38722757-38722779 CTCTGCAAGGATGGGGTCACTGG + Intergenic
993135908 5:83963922-83963944 TTCTAAAAGGGGGTTTTCACTGG - Intronic
994824835 5:104699315-104699337 CTCTGCACGGGGGTGGTGAGGGG - Intergenic
998230280 5:140357347-140357369 TTCTTGAAGGGAGTGGTCACAGG + Intergenic
1005285673 6:24324272-24324294 TTAGGTAAGGGGGTGGTCACTGG - Intronic
1008103369 6:47416487-47416509 CTCTGAGAGGTGGGGGTCACAGG + Intergenic
1011354306 6:86458291-86458313 CTCTGAGGAGGGGTGGTGACAGG - Intergenic
1013122138 6:107150333-107150355 CTCTGAACTGAGGTGGTCACGGG + Intergenic
1016717708 6:147252975-147252997 CTCTGAAAGGTTGTGGTATCAGG - Intronic
1017286868 6:152685937-152685959 CTCTAAAGGGGAGTGGTCAGCGG - Intergenic
1019419903 7:946082-946104 CTGTGAAGGGTGGTGGGCACCGG - Intronic
1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG + Intergenic
1024668302 7:51566871-51566893 CTCTGGAAGTGTGAGGTCACTGG + Intergenic
1026570037 7:71521358-71521380 CTGGGAAAGGAGGTGGTCAAAGG - Intronic
1028022856 7:85798460-85798482 CTTTGGAAGCGGGTGGTCATTGG - Intergenic
1029402901 7:100356647-100356669 CTTTGCCCGGGGGTGGTCACTGG - Intronic
1029405554 7:100372540-100372562 CTTTGCCCGGGGGTGGTCACTGG - Intronic
1030809410 7:113956297-113956319 CTCTGGCAGGGGGTGGCTACAGG + Intronic
1031073945 7:117194405-117194427 CTCTTAATGGGGGTGGTGAAGGG - Intronic
1034976998 7:155454666-155454688 CTCCGCAAGCGGGTGGTCGCGGG + Intergenic
1035564175 8:630258-630280 CTCTGCCTGTGGGTGGTCACGGG - Intronic
1035564276 8:630876-630898 CTCTGTCTGTGGGTGGTCACAGG - Intronic
1035665106 8:1374999-1375021 CACTGACAGCAGGTGGTCACTGG + Intergenic
1035861478 8:3033192-3033214 CTGTGAAAATGTGTGGTCACAGG - Intronic
1037532476 8:19791157-19791179 ATCTGTGAGGGGGTGGGCACTGG + Intergenic
1040488987 8:47901906-47901928 CTCTGAAATGGCCTGTTCACTGG + Intronic
1040598104 8:48859624-48859646 CTGTGCCTGGGGGTGGTCACGGG - Intergenic
1043400183 8:79876960-79876982 CTGTGAAAGGGGCTGTTCTCTGG + Intergenic
1043412679 8:80014904-80014926 ATCTGAGAGGTGGGGGTCACAGG + Intronic
1047376591 8:124303813-124303835 CTCTGGAAAGTGGTGGTCAGAGG - Intergenic
1047504194 8:125465967-125465989 CTCTGAATGGGGCTGAGCACAGG - Intergenic
1047748052 8:127860002-127860024 GTGTGAAAGGAGGTGTTCACGGG - Intergenic
1048522094 8:135165806-135165828 ATCTGAAATGGGGGGGTCTCAGG + Intergenic
1049032778 8:140049648-140049670 AGCTGAAAGGGGAAGGTCACAGG + Intronic
1049308135 8:141918588-141918610 CTCTGCAGGGGGCTGGGCACGGG + Intergenic
1050366430 9:4877801-4877823 CTCTGAAAAGGGGAGGTAGCGGG - Intronic
1051438503 9:17057523-17057545 CTCTGATTGGTGGTGGTGACGGG - Intergenic
1052155118 9:25177730-25177752 CTCTGAAAGGTGGTGGACATTGG - Intergenic
1052202171 9:25796457-25796479 CTTTCACAGGGGATGGTCACTGG - Intergenic
1052769138 9:32671547-32671569 CTCTGGAAGGAGGTGGGAACAGG - Intergenic
1057089432 9:92243567-92243589 CTCTGATAAGAGGTGGTCCCAGG - Intronic
1061367191 9:130178242-130178264 CTGTACAAGGGGGTGGCCACAGG - Intronic
1062660994 9:137633025-137633047 CTCAGGGAGTGGGTGGTCACCGG + Intronic
1186198042 X:7129635-7129657 CCCTGAGAGGCGATGGTCACTGG - Intronic
1187000382 X:15170802-15170824 CTCTGAAAGAGGGGGGACAATGG + Intergenic
1189887908 X:45568012-45568034 CTCTGGAATGGGGTGGAGACTGG + Intergenic
1191617738 X:63187931-63187953 CTCTGGAAGGGGGAGCTCCCAGG + Intergenic
1193283590 X:79685672-79685694 GTCTCAATGGTGGTGGTCACAGG - Intergenic
1195687034 X:107596912-107596934 CTCTGAAAAGGGGTGGGGACAGG + Intronic