ID: 903360147

View in Genome Browser
Species Human (GRCh38)
Location 1:22772029-22772051
Sequence ACACCAGGGCTTGCTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 0, 2: 21, 3: 139, 4: 633}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903360147 Original CRISPR ACACCAGGGCTTGCTGGGGA AGG (reversed) Intronic
900092860 1:927980-928002 AGGCCAGGGCTGGCTGGGAATGG - Intronic
900389627 1:2428292-2428314 GCAGCAGGCCTCGCTGGGGATGG + Intronic
900486102 1:2923553-2923575 GCCCCTGGGCTTCCTGGGGAAGG - Intergenic
900833675 1:4983988-4984010 ACAACAGGGCCTGCTAGGAAGGG + Intergenic
901171869 1:7265000-7265022 ACACCAGGGCCTGCAGGGGTGGG + Intronic
902365403 1:15969798-15969820 ACTCCAGGGGAAGCTGGGGAGGG - Intronic
902651798 1:17842248-17842270 ACAGCATGACTAGCTGGGGAGGG - Intergenic
903337770 1:22636469-22636491 ACACCAGCTGTTGCTGGGGCAGG + Intergenic
903360147 1:22772029-22772051 ACACCAGGGCTTGCTGGGGAAGG - Intronic
904042598 1:27593163-27593185 CCTCCAGGGCTGGCTGGGGCAGG + Intronic
905304411 1:37007556-37007578 CCACCGGGCCTGGCTGGGGATGG + Intronic
905349509 1:37335261-37335283 ACACCACGGCCTGTTGGGGGTGG + Intergenic
905726722 1:40258424-40258446 ACTCCAGGGCTGGCCGGGTATGG - Intronic
906148484 1:43573860-43573882 ACGCCAGGACTTGGTGGGGGTGG - Intronic
906229966 1:44153645-44153667 AGCCCAGGGCTTGTTGGTGATGG - Intergenic
906707228 1:47903648-47903670 ACCACAGGGCTTCCTGGGCAGGG + Intronic
906831251 1:49034084-49034106 AAAGGAGTGCTTGCTGGGGAAGG - Intronic
906891028 1:49715122-49715144 ACACCAGAGCCTGTTGGGGCTGG - Intronic
907591791 1:55680980-55681002 ACACCAGGGCCTGTTGGGGCGGG - Intergenic
907711609 1:56887967-56887989 ACACCAGGGCCTGTCGGGGATGG + Intronic
908016055 1:59837851-59837873 ACACCAGGGCCTGTGGGGGGTGG - Intronic
909541546 1:76797320-76797342 ACACTAGGGCCTGTTGGGGGTGG + Intergenic
909891450 1:81012882-81012904 ACACCAGGGCCAGTTGGGGATGG - Intergenic
909962975 1:81871091-81871113 ACAACAGGGCCTGTTGGGGGTGG - Intronic
910210559 1:84788593-84788615 ACACTGGGGCCTGTTGGGGATGG - Intergenic
910331522 1:86077822-86077844 ACACCAGGGCCTGTGGGGGTTGG + Intronic
910925523 1:92394310-92394332 ACACCAGGGCCTGTGGGGGGTGG + Exonic
911550184 1:99269082-99269104 ACACCAGGGCCTGTGGGGGTTGG - Intronic
911561416 1:99410699-99410721 ACACCAGGACCTGTTGGGGATGG - Intergenic
911595546 1:99794755-99794777 ACACCAGGGCCTGTGGGGGTTGG - Intergenic
912170030 1:107088273-107088295 ACACCGGGGCTTGTTGGGGGTGG - Intergenic
912642716 1:111362457-111362479 ACACCGGGACCTGTTGGGGATGG - Intergenic
913156224 1:116101769-116101791 ACACCAGGGCCTGCAGGGGGTGG - Intergenic
914691526 1:150032894-150032916 ACACTAGGGATTGGTGAGGACGG - Intergenic
915105994 1:153535496-153535518 AGCCCAGGGCTTGAAGGGGAAGG + Intronic
916226389 1:162493939-162493961 ACACTGGGGCCTGTTGGGGATGG + Intergenic
916312354 1:163411028-163411050 ACATCAGTGCGTGCTGGGGAGGG + Intergenic
916395792 1:164386027-164386049 ACACCAGGGCCTGCAGGGGGTGG - Intergenic
916635875 1:166667963-166667985 ACACCAGGGCCTGTCGGGGGTGG + Intergenic
916894741 1:169151131-169151153 ACCCCAGGGCTTCCAGGAGAGGG + Intronic
917055932 1:170981592-170981614 ACACCAGGGCTTGTTGGAGGTGG + Intronic
917715182 1:177728177-177728199 ACACCAGAGCCTGCTCGGGGGGG + Intergenic
918581250 1:186132800-186132822 ACACCAGGGCCTGTTGTGGGGGG - Intronic
918662496 1:187106694-187106716 ACCCCAGGGCCTACTGGGGAGGG - Intergenic
918662644 1:187108383-187108405 ACACCAGGGCCTGTCGGGGGTGG + Intergenic
918791028 1:188829213-188829235 ACACCGGGGCCTGTTGGGGGTGG - Intergenic
919063384 1:192663117-192663139 ACACCAAGGCCTGTTGGGGGTGG - Intergenic
919263310 1:195227356-195227378 ACACCAGGGCCTGTTAGGGGAGG - Intergenic
919330304 1:196162740-196162762 ATAGCAGGGGTGGCTGGGGAAGG - Intergenic
919745972 1:201009397-201009419 GCCCCAGGTCCTGCTGGGGAAGG - Exonic
919870871 1:201820237-201820259 ACTCCTGGGCTTTCTGGGGAGGG + Exonic
919920179 1:202162663-202162685 TCACCAGGCCAGGCTGGGGAGGG - Intergenic
919920332 1:202163355-202163377 CCACCAGGCCAGGCTGGGGAGGG + Intergenic
920652042 1:207845164-207845186 ACCTCAGGGCAGGCTGGGGAGGG - Intergenic
920703293 1:208233845-208233867 ATATCAAGGCTTGCTGTGGATGG + Intronic
920715625 1:208337576-208337598 TCTCCTGGGCTTGCTGGTGATGG + Intergenic
920994067 1:210970271-210970293 ACACCGGGGCCTGTTGGGGGTGG - Intronic
921008557 1:211117642-211117664 AGCCTAGGGATTGCTGGGGAAGG - Intronic
921009019 1:211122810-211122832 ACACCAGGTCCTGTTGGGGGTGG + Intronic
921361878 1:214337579-214337601 ACTCCAGGGTATGCTTGGGAAGG + Intergenic
921405135 1:214770783-214770805 ACACTGGGGCCTGTTGGGGATGG - Intergenic
921564993 1:216706059-216706081 ACATCAGGGGTTGCTGGGGGTGG - Intronic
922726548 1:227925546-227925568 CCAGCAGGGCTTCCTGGGGCCGG - Intronic
923423340 1:233843088-233843110 GCATCAGGGCATGGTGGGGAAGG + Intergenic
924414103 1:243840337-243840359 ACACCAGGGCCTGCTGGGGGTGG + Intronic
924580781 1:245322206-245322228 ACACCGGGGCCTGTGGGGGATGG + Intronic
1064236118 10:13577388-13577410 ACACCGGGGCCTGCAGGGGGTGG - Intergenic
1064785970 10:18894742-18894764 ACACTGGGGCCTGCTGGGGAGGG + Intergenic
1065364337 10:24920516-24920538 ACACTAGGTCCTGTTGGGGATGG + Intronic
1066488841 10:35874746-35874768 ACCCCATGGCTGACTGGGGAGGG - Intergenic
1067209333 10:44245889-44245911 AGACCAGGGCTTCCTGGGACTGG + Intergenic
1067413337 10:46084421-46084443 AAACCATGGCCTGTTGGGGAAGG + Intergenic
1067724516 10:48759768-48759790 ACACCAGGGGATGCTGCAGAGGG + Intronic
1068646698 10:59476063-59476085 ACACCAGGGCCTGTCGGGGGTGG + Intergenic
1068674247 10:59753705-59753727 ACACCAGGGCCTGTCGGGGAGGG + Intergenic
1068807076 10:61208832-61208854 ACACTGGGGCTTGTTGGGGGTGG - Intergenic
1069785582 10:70985953-70985975 AGAGCAGGGCTGGGTGGGGAAGG + Intergenic
1070024318 10:72617508-72617530 ACACCAAAGCTTGCTGGGCATGG + Intronic
1070490305 10:76969860-76969882 CACCCCGGGCTTGCTGGGGAGGG + Intronic
1070702032 10:78610974-78610996 ACACCAGGGCTTGCTGGGTCAGG - Intergenic
1071294837 10:84211907-84211929 CAAGCAGGGCTGGCTGGGGAGGG + Intronic
1071439796 10:85680081-85680103 ACTCCAGGGCTTCCTTGGAATGG - Intronic
1071562553 10:86655360-86655382 ACACCACTGCTACCTGGGGAAGG + Intronic
1071609019 10:87018149-87018171 ACACCATGGCCTTCTGGGCAAGG - Intergenic
1071913751 10:90266724-90266746 ACACTGGGGCCTGCTGGGGGTGG + Intergenic
1072054461 10:91740620-91740642 ACACCTGTGCTGGCAGGGGAGGG + Intergenic
1072607466 10:96996802-96996824 ACAGCCGGGCTTGGTTGGGAGGG - Intergenic
1073626433 10:105102512-105102534 ACACCAGGGCTTACTTTTGAGGG + Intronic
1073948058 10:108775396-108775418 ACACTGGGGCCTGTTGGGGAGGG - Intergenic
1074148868 10:110740602-110740624 CCACCAGGGCTTGGTAGGGGTGG + Intronic
1076103225 10:127799045-127799067 ACAGAAGATCTTGCTGGGGAGGG - Intergenic
1076171678 10:128325195-128325217 ACACCAGGGCTTACAGCTGAAGG + Intergenic
1076334569 10:129696895-129696917 ACTCCAGGCCTTGCTTTGGAGGG + Intronic
1076855572 10:133114075-133114097 ACAGCAGCGCTGGCTGAGGAAGG + Intronic
1077408807 11:2394171-2394193 ATCCCAGTGCCTGCTGGGGACGG + Exonic
1078040704 11:7860133-7860155 ACACCAGGGCCTACTGGGGGTGG + Intergenic
1078420326 11:11206548-11206570 AAATCAGGGCTTCCTAGGGAGGG - Intergenic
1078684946 11:13520654-13520676 ACACCAGGGCCTGCTGGAGTGGG + Intergenic
1079006572 11:16795349-16795371 ACAACAGTGGTTGCTGGGGGCGG + Intronic
1079114409 11:17631955-17631977 CCTCCTGGGCTGGCTGGGGATGG + Intronic
1079951269 11:26808057-26808079 AAAGCAGGGCTTGCTTGGAAGGG - Intergenic
1080480485 11:32644318-32644340 ACACCAGGGCCTACTGAGGGTGG + Intronic
1080505715 11:32911269-32911291 ACACCAGGGCCTCCTGGGGGTGG + Intronic
1080670725 11:34374144-34374166 ACACCAGGGCCTGTTGGGGGTGG - Intergenic
1081050812 11:38338356-38338378 ACACTGGGGCCTGTTGGGGAGGG + Intergenic
1081504107 11:43696995-43697017 ACACCAGGACTTGTTGCGGGGGG + Intronic
1082026112 11:47573514-47573536 ACACCAGGGTGTGCTGGAGCCGG + Exonic
1082965041 11:58958697-58958719 CCAGCAGGGGGTGCTGGGGAGGG + Intronic
1083479370 11:62933851-62933873 ACACCTGGCCCTGCAGGGGAAGG - Intergenic
1083594319 11:63911795-63911817 ACACCAGAGATGCCTGGGGATGG + Exonic
1084148488 11:67277396-67277418 ACAGCTGGGCTGGCTGGGGTAGG - Intronic
1084269503 11:68021475-68021497 ACACGAGGGCTCCCTGGGCATGG - Exonic
1085599207 11:77839803-77839825 ACACTGGGGCTTGCTGGTGGGGG + Intronic
1085836710 11:79964432-79964454 TCACCAGTGCTTCCTGGGAAGGG + Intergenic
1085848610 11:80094907-80094929 ACACCAGGGCCTGTTGGGGGTGG - Intergenic
1085953225 11:81358713-81358735 ACACCAGGGTCTGTTGGGGGTGG + Intergenic
1086085505 11:82950529-82950551 ACACCAAGGCCTGTTGGGGGTGG - Intronic
1086311732 11:85543143-85543165 ACACCAGAGCCTGTTGAGGATGG - Intronic
1086328798 11:85732577-85732599 ACACCAGGGCCTGTTGGGGTGGG + Intronic
1086404357 11:86487383-86487405 ACACCAGCGCGTGCACGGGAAGG - Exonic
1087404331 11:97711507-97711529 ACACCTGGGCTTGTTGCAGAGGG + Intergenic
1087410003 11:97779629-97779651 ACACCAGGGCCTGTTGGGGTGGG - Intergenic
1087663378 11:101013728-101013750 ACACCAGGGCCTGTTGGGAGTGG - Intergenic
1087686254 11:101268988-101269010 ACACCAGGGCCTGTTGGGGGTGG - Intergenic
1087697284 11:101394267-101394289 ACACCAGGGTCTGTTGGGGTTGG - Intergenic
1088780916 11:113133030-113133052 ACAGCAGGGCTGTCTGGGTATGG - Intronic
1088795182 11:113261492-113261514 TCCCCAGTGCTTGCTGGGGTGGG + Intronic
1089185756 11:116613682-116613704 AAACCAGGGGGTGCTGGGCAAGG + Intergenic
1089186514 11:116619242-116619264 ACACCAGGGCCTGTGGGGGTGGG - Intergenic
1089586425 11:119512566-119512588 CCTCCAGGGCTCCCTGGGGATGG + Intergenic
1089629438 11:119774934-119774956 AAAACAGGGCTGGGTGGGGAAGG - Intergenic
1089696423 11:120218826-120218848 ACCCCAGGGCTTTCTGGGGAGGG + Intronic
1089922122 11:122219268-122219290 ACACCAGGGCTGGCTAGGGAAGG - Intergenic
1090252828 11:125263398-125263420 ACAGCAGGGACTGCTGGCGACGG + Intronic
1090356429 11:126143512-126143534 ACACCAGGGCCTGTCGGGGCAGG - Intergenic
1090363683 11:126189727-126189749 GGTCCAGGGCCTGCTGGGGAGGG - Intergenic
1090363963 11:126191078-126191100 ACACCAGCCACTGCTGGGGAAGG - Intergenic
1090795778 11:130134726-130134748 ACCCCAGGGACAGCTGGGGATGG + Intronic
1091018305 11:132074247-132074269 ACACCAGGCCTTGCTTGTGAGGG + Intronic
1091265789 11:134270105-134270127 ACACCAGGGGTGGATGAGGAGGG + Intergenic
1091631992 12:2169009-2169031 ACACCTGTCCTTGCTGGGGAGGG + Intronic
1091863758 12:3811362-3811384 ACACCACGACTTGCTGTGCAAGG - Exonic
1092052964 12:5485999-5486021 ACACCATGGTTTTCTGGAGAAGG + Intronic
1092776685 12:11949938-11949960 TCACCTGGGCCTGCAGGGGAAGG + Intergenic
1093523043 12:20072739-20072761 ACACCAGGGCTTGTTGGAGGTGG + Intergenic
1093734634 12:22606532-22606554 ACACCAGGGCCTGTCGGGGTGGG + Intergenic
1093866850 12:24237902-24237924 TCACCAGGGATTCCTGGAGATGG - Intergenic
1095649826 12:44594125-44594147 ACACCGGGGCCTGTTGGGGGTGG + Intronic
1095919251 12:47513030-47513052 ACACCAGGGCCTGTTGTGGAGGG + Intergenic
1096884608 12:54704255-54704277 ACACCAGGGCCTGTTGGGGATGG - Intergenic
1097035248 12:56119591-56119613 ACTCCAGGTCTTACTGGGGGTGG + Intronic
1097243419 12:57591589-57591611 ACACCTGGGGTTGGTGGGCAGGG - Intronic
1097609103 12:61795564-61795586 ACACCAGGGCCTGTTGGGTGGGG + Intronic
1098113860 12:67153804-67153826 ACACCAGGGCCTGTTGGGGATGG + Intergenic
1098798440 12:74922836-74922858 ACACCAGGGTCTACTGGGGCGGG - Intergenic
1098979277 12:76937578-76937600 ACACTGGGGCTTGTTGGGGGAGG - Intergenic
1099738926 12:86605730-86605752 ATACCAGTGCTTGCTGGGAATGG - Intronic
1100154636 12:91783528-91783550 ACACTGGAGCCTGCTGGGGACGG + Intergenic
1100390300 12:94141401-94141423 ACACCAGAGATGCCTGGGGATGG - Intergenic
1100960949 12:99962207-99962229 ACACCAGGGCCTGATGGGGGTGG - Intronic
1102609811 12:114101844-114101866 ACACCAGGGCCTGTTGGGGAGGG + Intergenic
1102689960 12:114752701-114752723 ACCCCAGGGGATGCTGGGGCAGG + Intergenic
1103068192 12:117917608-117917630 ACACCAGGGCATGGGGGGTAGGG + Intronic
1103641286 12:122354544-122354566 ATTCCAGGACATGCTGGGGAAGG + Exonic
1104021387 12:124994389-124994411 AAACCCGGGGTAGCTGGGGAGGG - Intronic
1104971289 12:132532051-132532073 CCACAAGAGCTTGCTGGGGTTGG + Intronic
1105317742 13:19282708-19282730 ACACCAGGGCCTGCCGGGGTTGG + Intergenic
1105678628 13:22703121-22703143 GCACCAGGGCTTGGTGTGGGGGG - Intergenic
1105874962 13:24542951-24542973 ACACCAGGGCCTGTCGGGGGCGG - Intergenic
1106735717 13:32586479-32586501 ACGGCAGGGCTGGCTGCGGAAGG + Exonic
1107472880 13:40706897-40706919 ACACCAGGGCCTGTGGGGGATGG - Intergenic
1107586140 13:41850362-41850384 ATACCAGGGCCTGCTGGGCTGGG - Intronic
1108998855 13:56769190-56769212 ACAACAGGGCCTGTTGGGGGTGG + Intergenic
1109417686 13:62064442-62064464 ACACCAGGGCCTGTTGGGTGTGG + Intergenic
1109487501 13:63046580-63046602 ACACCATGTCTTGCTTGGGAAGG - Intergenic
1109662620 13:65484285-65484307 ACACCAGGGCCTGTTGGGGATGG - Intergenic
1110033359 13:70646865-70646887 ACACCAGGGACTGTTGGGGGTGG - Intergenic
1110291612 13:73814243-73814265 CCACCACTGCTTGCGGGGGAAGG + Intronic
1110829751 13:80017501-80017523 ACACTGGGGCTTGCTGGGGGTGG + Intergenic
1111200568 13:84929906-84929928 ACACCAGGGCCTGTTGGGGCTGG + Intergenic
1111266036 13:85814719-85814741 ACACCAGGGCCTGTTGGGGTGGG - Intergenic
1111575024 13:90142686-90142708 ACACCAGGGCCTGTCGTGGAAGG - Intergenic
1111867110 13:93782980-93783002 ACACTGGGGCCTGTTGGGGAAGG - Intronic
1112907796 13:104445882-104445904 ACACCAGGGCCTGTCGGGGTGGG + Intergenic
1113952407 13:114079357-114079379 AGCCCAGGGCCTGTTGGGGAAGG + Intronic
1114184623 14:20391148-20391170 CCTCCAGGGCTGGCTGGGCAAGG - Intronic
1114346985 14:21806868-21806890 ACACCAGGGCCTGTCGGGGGAGG + Intergenic
1114357542 14:21928233-21928255 ACACTGGGGCCTGTTGGGGAGGG + Intergenic
1114363796 14:22005157-22005179 ACACCAGGGCCTGTTGTGGGTGG - Intergenic
1115538613 14:34397482-34397504 ACACCAGGGCCTGTCGGGGGTGG + Intronic
1115730184 14:36260180-36260202 ACACCGGGGCCTGTTGGGGGTGG + Intergenic
1116254359 14:42532155-42532177 ACACTAGGGCGTGTCGGGGATGG + Intergenic
1116489555 14:45490044-45490066 ACACCAGGGCCTGTTGGGGCTGG + Intergenic
1116565887 14:46443634-46443656 ACACCAGGGCCTGTCGGGGGTGG + Intergenic
1116767062 14:49085728-49085750 ACACCAGGGCCTGTCGGGGTTGG - Intergenic
1116915208 14:50518400-50518422 ACACTAGGGCTTGTTGGTGGTGG - Intronic
1117426896 14:55609157-55609179 ACACCAGGGCCTGTTGCGGGTGG - Intronic
1117459548 14:55931512-55931534 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
1118052488 14:62044458-62044480 ACACCAGGGCCTGTTGGGGGTGG - Intronic
1118318720 14:64741158-64741180 CCACCAGGGCCTTCTGGGGATGG + Exonic
1119460012 14:74793884-74793906 ACACTAGGGGGTGCTAGGGAAGG - Intronic
1119522428 14:75295747-75295769 ACACCAGGGCCTGGGGGGGATGG + Intergenic
1120806855 14:88761357-88761379 ATACCAGGGCCTGTTGGGGCTGG - Intronic
1120852859 14:89186858-89186880 ACACCATGTCTTGCTTGGGCTGG - Intronic
1121490603 14:94356423-94356445 ACAGCAGTGCCTGCTGTGGACGG - Intergenic
1121938775 14:98046787-98046809 ACACAATGGCTGGTTGGGGACGG - Intergenic
1122160899 14:99783148-99783170 ACACCAGGGCCTGTTGTGGGTGG - Intronic
1122544019 14:102512473-102512495 ACACTGAGGCTGGCTGGGGAGGG - Intergenic
1123037296 14:105476724-105476746 ACACCAGGGCAGGCAGGGGCTGG - Intronic
1123038782 14:105481971-105481993 ACCCCAGGTCTGGCTGGGGCAGG + Intergenic
1123178541 14:106445026-106445048 ACACCAGGGCCTGTCGGGGTGGG - Intergenic
1123400986 15:19986224-19986246 ACACCAGAGCCTGTTGGGGGTGG + Intergenic
1124220826 15:27848295-27848317 ACCCCAGGAGATGCTGGGGAAGG - Intronic
1126425547 15:48523696-48523718 ACACCAAGGGTGGCTGGGGGGGG + Intronic
1126497988 15:49313516-49313538 AAGACAGGGCTTGCTGGGGAAGG - Intronic
1126891144 15:53205655-53205677 ACACCGGGGCCTGATGGGGGTGG - Intergenic
1127362407 15:58256007-58256029 ACACCAGGCATTGCTGAAGACGG + Intronic
1127732462 15:61813472-61813494 ACACCAGGGGTTCCAGGAGAAGG + Intergenic
1128870833 15:71154210-71154232 ACAGCAGGGTGTGCTGGAGAGGG - Intronic
1129333463 15:74839361-74839383 CCACCAGGGCGGTCTGGGGATGG + Exonic
1129392428 15:75227022-75227044 ACTCCAGGGCTTCCAGGAGAGGG - Intergenic
1129471964 15:75761162-75761184 ACTCCAGGGCTTCCAGGAGAGGG + Intergenic
1129571277 15:76687597-76687619 GCACCGGGGCCTGTTGGGGATGG - Intronic
1129819185 15:78585203-78585225 ACACTAGAGCTGGCTGGGCACGG - Intronic
1129856565 15:78829376-78829398 ATACCAGGGCTGGCTGGGCACGG + Intronic
1130072010 15:80655377-80655399 ACACCATGACCTCCTGGGGAAGG - Intergenic
1130582861 15:85154188-85154210 AGGCTAGGGCTTGCTTGGGAGGG + Intergenic
1132159936 15:99531246-99531268 ACACTAGGGCTTGTTGTGGGTGG - Intergenic
1132240620 15:100254828-100254850 ACACCAGGGCCAGCCGGGGGAGG + Intronic
1132344854 15:101102045-101102067 ATCCCAGTGCTGGCTGGGGATGG - Intergenic
1132557359 16:578536-578558 ACCCCAGAGCTTGCTGAAGAGGG + Intronic
1132805935 16:1775154-1775176 ACAGCAGGGCTGGCTGGGACGGG + Intronic
1133822207 16:9246741-9246763 ACACCAGGGCTTGAAGGTGGTGG + Intergenic
1134877860 16:17718172-17718194 ACACCAGGGCCTGTTGGCGGGGG + Intergenic
1134877912 16:17718567-17718589 ACCCCAGAACCTGCTGGGGAAGG - Intergenic
1135005006 16:18812826-18812848 ACACCGGGGCTTGTTGTGGGTGG - Intronic
1135753173 16:25073403-25073425 TCAACAGGGCTTGCTGGGGCCGG - Intergenic
1135948064 16:26882951-26882973 ACACCAGTGCCTGTTGGGGGTGG + Intergenic
1136285598 16:29238721-29238743 AGACCTGGCCCTGCTGGGGAAGG - Intergenic
1137072356 16:35914569-35914591 ACACCATGGCCTGCTGCCGAGGG - Intergenic
1137556413 16:49473182-49473204 CCACCAGGGATGGCTGGAGAAGG - Intergenic
1137673013 16:50290468-50290490 ACACCAGGCCATTCTGGGCATGG + Exonic
1137766586 16:50982100-50982122 GAATCAGGGGTTGCTGGGGATGG - Intergenic
1137804487 16:51290990-51291012 ACTGCAGGGCTTGTTGGTGAGGG - Intergenic
1137898297 16:52237767-52237789 AAACCAGGAATTGCTGGGGGTGG + Intergenic
1138550839 16:57747603-57747625 ACACCAGGGCATGCTGTGCTTGG + Intronic
1138804244 16:60075602-60075624 ACACCGGGGCCTGTTGGGGGTGG - Intergenic
1139853103 16:69962324-69962346 ACACCAGGGGACACTGGGGATGG - Intronic
1139882074 16:70185232-70185254 ACACCAGGGGACACTGGGGATGG - Intronic
1140586622 16:76300385-76300407 ACACCAGGGCCTGTCGGGGTTGG + Intronic
1140657526 16:77155839-77155861 ACACCAGGGCCTGTGGGGGGTGG + Intergenic
1141052759 16:80786904-80786926 ACACCAGGGCCTGTGGGGGGTGG + Intronic
1141785334 16:86196154-86196176 GCCGCAGGGCTGGCTGGGGAGGG + Intergenic
1142090931 16:88208897-88208919 AGACCTGGCCCTGCTGGGGAAGG - Intergenic
1142666969 17:1468752-1468774 CCACCAGGGCCTGATGGGGTGGG - Intronic
1142869114 17:2809137-2809159 TCACCAGGGCTTCCTGGGCATGG - Intronic
1143032328 17:3974556-3974578 GCAGCAGGGCTGCCTGGGGAGGG - Intergenic
1143514774 17:7414160-7414182 CTGCCAGGGCTAGCTGGGGAGGG + Intronic
1143735125 17:8906162-8906184 ACACCGGGGCCTGTCGGGGATGG - Intronic
1144138342 17:12320846-12320868 ACACCAGGGCAGGCTTGGCAGGG - Intergenic
1144321351 17:14123746-14123768 TAACCAGGGCTTTCTGTGGATGG + Intronic
1144808563 17:17983928-17983950 ACACCTGGTCTGGCTGGGTAAGG + Exonic
1144814976 17:18027647-18027669 GCACCAAGGCTGCCTGGGGAAGG - Intronic
1144944378 17:18962245-18962267 ACAGCGGGGCTTGCTGGGGGTGG + Intronic
1145261069 17:21355176-21355198 ACAGCTGGGCCGGCTGGGGAAGG - Intergenic
1145355308 17:22140472-22140494 ATACCATGTCTTGCTTGGGATGG + Intergenic
1145782125 17:27570266-27570288 ACACAAGGGCTGGCTGGTGGTGG + Intronic
1145790355 17:27622816-27622838 TCAGCAGGTCTTGCTGGGGAGGG - Exonic
1145863957 17:28228268-28228290 AGACCAGGGGCTGCTGTGGAAGG + Intergenic
1146729181 17:35179735-35179757 ACACCGGGGCCTGTTGGGGGTGG + Intronic
1148685850 17:49500845-49500867 TCATCAGGGTTTGGTGGGGAAGG - Intronic
1148872103 17:50664412-50664434 ACACAAGAGCTGGCTGGGCACGG + Intronic
1150945904 17:69745225-69745247 ACACAAAGGCCTGGTGGGGAAGG + Intergenic
1151418101 17:73979874-73979896 GCACCAGAGCTAGATGGGGAAGG - Intergenic
1151512554 17:74570256-74570278 GGACAAGGGCCTGCTGGGGAAGG - Intergenic
1151963499 17:77419541-77419563 TCCCCAGGGCTGGCTGGGAATGG + Intronic
1151975004 17:77479741-77479763 CCCCCAGGTCCTGCTGGGGAGGG + Intronic
1152633096 17:81419515-81419537 ACACCAGGAGTGGCTGGGAACGG - Intronic
1203169509 17_GL000205v2_random:135079-135101 AAACCAGGCCTTGCTTGGTAAGG - Intergenic
1153214699 18:2809002-2809024 ACAAAAGGGCTGGCTGGGCATGG + Intergenic
1153463360 18:5362049-5362071 ATACCAGGGCCTGTTGGGGGTGG + Intergenic
1153870465 18:9314711-9314733 ACACTGGGGCTTGTTGGGGGAGG + Intergenic
1153908915 18:9689267-9689289 ACACCGGGGCCTGTTGGGGGAGG - Intergenic
1154239838 18:12642748-12642770 ACACCAGGGCCTGTCAGGGATGG + Intronic
1154364614 18:13695698-13695720 ACACCAGGGCCTGCGGTGGGTGG + Intronic
1155633736 18:27925709-27925731 CCACCAGGGCCTGCCGGGGGTGG - Intergenic
1155693475 18:28654885-28654907 ACACCAGGGCTTGTGGGGACTGG + Intergenic
1155803010 18:30132419-30132441 ACACCAGGGCCTGTCGGGGGAGG + Intergenic
1155848312 18:30736932-30736954 ACACCAGGGCCTGTTTGGGGTGG + Intergenic
1156419587 18:36936282-36936304 ACACCAGGGCCTGTTGGGGGTGG - Intronic
1156481692 18:37440368-37440390 CCACCAGGCCTTGCTGGCCATGG + Intronic
1156507707 18:37609041-37609063 ACTCCAGGCCTTGGTGGGGTTGG - Intergenic
1156911648 18:42417605-42417627 AGAGAAGGGCTGGCTGGGGATGG - Intergenic
1157216952 18:45792183-45792205 ACACCAGGGCTTGTGGGGGGTGG + Intergenic
1157709447 18:49839951-49839973 ACAACAGGCCTTGCTGAAGATGG - Intronic
1158422956 18:57312504-57312526 CCACCAGGGCCTGGAGGGGAAGG - Intergenic
1158767646 18:60474231-60474253 ACACCAAGGCTTGTTGGGTGTGG + Intergenic
1158858399 18:61567489-61567511 ACACTAGGGCCTGTTGGGGAGGG - Intergenic
1159558129 18:69966427-69966449 ACACCAGGGCCTGTTGTGGGGGG + Intergenic
1159628341 18:70720272-70720294 ACACCAGGACCTGTTGGGTAGGG + Intergenic
1159658537 18:71062567-71062589 ACACCGGGGCCTGTTGGGGGTGG - Intergenic
1159690350 18:71479414-71479436 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
1159927816 18:74284380-74284402 TCACTAGGGATTGTTGGGGAGGG + Intronic
1160174798 18:76584304-76584326 GCACCTGGGTGTGCTGGGGATGG + Intergenic
1160369471 18:78359960-78359982 ACACTGGGGCCTGTTGGGGAGGG + Intergenic
1160517700 18:79487560-79487582 ACACCTGGGGTTGTTAGGGAAGG + Intronic
1160681501 19:413465-413487 ACAGGAGGACTTGCTGTGGAGGG - Intergenic
1160783587 19:889537-889559 AAACCAGGGGATGCTGGTGATGG + Intronic
1160874674 19:1291477-1291499 CCAGCAGGTCTTGCTGGGGGTGG + Intronic
1160946109 19:1644810-1644832 ACAGCAGGGCCTGGTGGGGAGGG - Intronic
1161614545 19:5262771-5262793 ACACTAGTGCCAGCTGGGGAGGG + Intronic
1161684493 19:5696210-5696232 GGGCCTGGGCTTGCTGGGGAGGG - Intronic
1161699174 19:5785576-5785598 GCACCGGGGCTGGCTGGGGTGGG - Intronic
1164460015 19:28438811-28438833 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
1164592934 19:29516098-29516120 AAACCAGGGCTTTCTGTGGCTGG + Intergenic
1164637225 19:29800333-29800355 ACAGCAGGGCCTCCTGGGGAGGG + Intergenic
1165091152 19:33389026-33389048 GCAGCTGGGCTTCCTGGGGAGGG - Intronic
1165263927 19:34645047-34645069 ACACCTGGGCGTGCAGTGGAAGG - Intronic
1165895559 19:39139052-39139074 AGCCCATGGCTGGCTGGGGAGGG + Intronic
1166315303 19:41985986-41986008 TCACCAGGGCTTGCTGAGGTGGG + Exonic
1166542458 19:43614490-43614512 ACAGTTGGGCTTGGTGGGGATGG - Exonic
1166776429 19:45315639-45315661 AGACCTGGGCTTGCTGGAGAGGG - Intronic
1166938683 19:46350179-46350201 AGACCAGGGCTGGGTGGGGCTGG + Intronic
1166966333 19:46531363-46531385 AGACCAGGGTTGGCTGGGCACGG - Intronic
1168311595 19:55463582-55463604 CCCCCAGGGCATGCTGGGGAAGG + Intergenic
1168326103 19:55539222-55539244 ACACCAGGGGAGGCTGGGGGAGG - Intergenic
925178457 2:1800866-1800888 ACACCGTGGCCTGCTGGGGAGGG + Intronic
926226557 2:10971181-10971203 ACCCCAGGGCTTGAAGGGGAGGG - Intergenic
926508589 2:13745470-13745492 ACACTAGAGCTTGATGGGGGAGG + Intergenic
927142880 2:20141678-20141700 TCATCAGGGTTTGCTGGGAAAGG - Intergenic
927155660 2:20219828-20219850 ACACCAGGTCCTGCTGGGGGTGG - Intronic
928406641 2:31020054-31020076 AAGCCAGGGTGTGCTGGGGAAGG - Intronic
928882164 2:36108934-36108956 ACACCAAGGCCTGTTGTGGAGGG + Intergenic
929371258 2:41226346-41226368 ACACCAGGGTCTGTTGGGGATGG + Intergenic
930556944 2:52908172-52908194 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
930696717 2:54419199-54419221 ACACCAGGGCCTGTTGGGTGGGG + Intergenic
930731249 2:54729978-54730000 ATACAAGGGCTGGCTGGGCATGG + Intronic
930765622 2:55082451-55082473 AAGGCTGGGCTTGCTGGGGATGG - Intronic
930861788 2:56081924-56081946 ACACCGGGGCCTGTTGGGGGTGG + Intergenic
931005241 2:57843279-57843301 ACACTAGGTCTTGCTTGGGTTGG + Intergenic
931076877 2:58725218-58725240 ACACTGGGGCTTGTTGGGGGTGG + Intergenic
931547221 2:63402300-63402322 ACACAAGGGCCTGTTGGGGGTGG + Intronic
931917908 2:66979210-66979232 ACACCAGGGCCTGTCGGGGCGGG + Intergenic
932045931 2:68349943-68349965 ACACCAGGACCTGTTGGGGTTGG + Intergenic
932471520 2:71962503-71962525 ACACCAAGGCTGGCTGGGCCTGG + Intergenic
932513776 2:72323819-72323841 ACACCAGGGCCTGTTGGGGGTGG + Intronic
933076490 2:77934011-77934033 ACACCAGGGCCTGTTAAGGAGGG + Intergenic
933396169 2:81734030-81734052 ACACCAGGGCTAGAGGGAGATGG - Intergenic
933500087 2:83100584-83100606 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
935506451 2:103910607-103910629 ACACCAGGGCCTGTTGGGGTTGG - Intergenic
936398617 2:112149276-112149298 ACACCATGGCCCGCTGGGAAAGG + Intronic
936580760 2:113698595-113698617 ACACCAGGGCCTATTGGGGGTGG + Intergenic
936777976 2:115996791-115996813 ACACCAGGGCCTGTTGGGGTGGG - Intergenic
937364286 2:121249491-121249513 GCACCTGGGCTTGCTGGGGTTGG - Intronic
937893403 2:126957772-126957794 ACATCAGGGCCTGTTGGGGGTGG - Intergenic
937917351 2:127105745-127105767 CCACCAGGCCTGGCAGGGGAAGG + Intronic
937932103 2:127214653-127214675 ACACCAGGGCCTGCTGGGGTGGG + Intronic
937958548 2:127437721-127437743 GCACCAGGCCTTGCAGGGGTTGG - Intronic
938088277 2:128416128-128416150 ATCCCAGGGCTTGCTTGGGATGG + Intergenic
938410954 2:131064048-131064070 ACAGATGGGCTTCCTGGGGAGGG - Intronic
938922417 2:136007558-136007580 ACACCAGGGCCTGTCGGGGGTGG + Intergenic
938998365 2:136704621-136704643 ACATCAGGGCTTTCGGGGGGTGG + Intergenic
939548851 2:143588491-143588513 CCACCAGGGCTTGTTAGGGGTGG - Intronic
939981692 2:148790178-148790200 ACACCGGGGCCTGTTGGGGAAGG - Intergenic
940066517 2:149636045-149636067 ACACCAGGGCCTGTTGGGTGTGG - Intergenic
940786622 2:157988601-157988623 ATACCAGGGCCTGTTGGGGGTGG + Intronic
940909631 2:159198977-159198999 GGTCCAGTGCTTGCTGGGGATGG + Exonic
940938581 2:159528945-159528967 ACACCAGGGCCTGTTGTGGGGGG + Intronic
940950458 2:159666913-159666935 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
941040929 2:160622843-160622865 ACACTAGGGCCTGTGGGGGATGG + Intergenic
941126467 2:161590182-161590204 ACACCAGGGCCTGTTGTGGGGGG - Intronic
941214192 2:162685180-162685202 ACACCGGGGCCTGTTGGGGCTGG + Intronic
942049294 2:172123858-172123880 ACACCGGGGCCTGCTGGGGAGGG - Intergenic
942182083 2:173389806-173389828 AAGCCAGGGAGTGCTGGGGAGGG + Intergenic
943291550 2:186078626-186078648 ACACCAGGGCCTGTTGTGGGTGG + Intergenic
943741180 2:191410816-191410838 ACACCAGGGCCTAGTGGGCACGG - Intronic
946134350 2:217633546-217633568 AGCCCAGGGGTTGCTGGTGAGGG - Intronic
946190982 2:218007858-218007880 ATGCCAGGGCTTGGTGGGTAGGG - Intergenic
947314746 2:228843815-228843837 ACACCAGGGCGTTGTGGGGTTGG + Intergenic
947681418 2:232037379-232037401 ACACTTGAGCTTGGTGGGGAGGG - Intronic
947895024 2:233663141-233663163 ACACCAGGGCTTGGAGGAGAGGG - Intronic
948262547 2:236614872-236614894 ACACCAGGGCCTGGTGGAAACGG + Intergenic
948431717 2:237923105-237923127 TCACCTGTGCTTCCTGGGGATGG + Intergenic
948577332 2:238963411-238963433 ACACCAGGGCATCCTGCGGCTGG - Intergenic
948663978 2:239523278-239523300 ACACCAGGGCAAGCTTGGGAAGG - Intergenic
1168997551 20:2144471-2144493 ACACCAGGACTTGCAGTGGTGGG + Exonic
1169019665 20:2320020-2320042 ACAGCAGGGCTCCCTTGGGAGGG - Intronic
1170726216 20:18929389-18929411 ACACCAGGGCCTGTTGGGGGTGG - Intergenic
1170853708 20:20028322-20028344 ACACCAGGGCCTGTCGGGGGTGG + Intronic
1171487378 20:25494562-25494584 CTTCCAGGGCTGGCTGGGGACGG - Intronic
1172387722 20:34545829-34545851 ACGCCAGGACTTGCTGGGGAGGG + Intergenic
1172602042 20:36190643-36190665 ACCCAAGGGCTTCCTGGTGATGG + Exonic
1172803999 20:37598332-37598354 ACACCAGGCCCTGCAGGGGGAGG - Intergenic
1173793683 20:45844045-45844067 ACACAAGGCCTTTCTGAGGAAGG - Intronic
1173838238 20:46139467-46139489 AGACCAGGGCAGGCTAGGGAGGG - Intergenic
1174342359 20:49905925-49905947 AGTCGAGGCCTTGCTGGGGAAGG + Exonic
1174479384 20:50820216-50820238 ACACTGGGGCTTGATGGGAATGG - Intronic
1174736012 20:52966551-52966573 ACACCATGGCCTGTTGGGGTGGG - Intergenic
1174791243 20:53480357-53480379 ACACCTGGGTTGGCTGGGCACGG - Intronic
1175401471 20:58701929-58701951 AGGGCAGGGCTTGCTGGGGCGGG - Intronic
1175571946 20:60030064-60030086 AAACCAGGGGTTGTGGGGGAAGG - Intronic
1175674912 20:60938198-60938220 TCACCAGGACTTGTAGGGGAAGG - Intergenic
1175764402 20:61582610-61582632 GCACCAGGCCCTGCAGGGGACGG - Intronic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1176402246 21:6324070-6324092 AAACCAGGCCTTGCTTGGTAAGG + Intergenic
1176434911 21:6665034-6665056 AAACCAGGCCTTGCTTGGTAAGG - Intergenic
1176459173 21:6992104-6992126 AAACCAGGCCTTGCTTGGTAAGG - Intergenic
1176675465 21:9773040-9773062 ACAGCAGGGCAGGCTGGCGATGG - Intergenic
1176919413 21:14669120-14669142 ACACCAGGGCCTGTTTGGGTTGG - Intergenic
1177388671 21:20439184-20439206 ACACTGGGGCCTGCTGGGGGTGG + Intergenic
1177437766 21:21079019-21079041 ACACCAGGGCCTGTTGGTGATGG + Intronic
1177512959 21:22113989-22114011 ACACCAGGGCCTGTGGGGGTTGG + Intergenic
1177853214 21:26373418-26373440 ACACCAGGGCCTGTGGGGGCTGG - Intergenic
1178160244 21:29904108-29904130 ACACCAGGGCCTGTGGGGAATGG + Intronic
1179361087 21:40709496-40709518 ACACCGGGGCCTGTTGGGGTTGG - Intronic
1180047501 21:45316392-45316414 ACACCAGGTCCTGTTGGGGGAGG + Intergenic
1180047966 21:45318477-45318499 GGCCCAGGGCTTGGTGGGGAAGG - Intergenic
1180051456 21:45333382-45333404 GCACAGGGGCTTGCTGGTGAGGG - Intergenic
1180169431 21:46050242-46050264 ACAGCGGGGCTCTCTGGGGAGGG + Intergenic
1180967702 22:19799149-19799171 AGACCAGGGCTGCCTGGGGTGGG + Intronic
1181153448 22:20901759-20901781 ACTCCTGGGCTTGCCGGGCACGG - Intergenic
1181374396 22:22444384-22444406 ACACCGGGGCCTCTTGGGGATGG + Intergenic
1181445771 22:22972979-22973001 ACACCAGGGCCTGTTGGGGATGG + Intergenic
1181528564 22:23503133-23503155 ACACCTGGGCTAGCGGGGAAGGG + Intergenic
1182601319 22:31466608-31466630 AAATCAGCGCTTGCTTGGGAAGG + Intronic
1183227055 22:36557612-36557634 AGATCAAGGCTTGCTGGGGCAGG + Intergenic
1183338454 22:37264642-37264664 GCAGCAGGGCTTGCTCGGGCAGG + Intergenic
1183490353 22:38112422-38112444 ACACTAGGGCTGGGAGGGGAAGG + Intronic
1183634445 22:39052495-39052517 AGACCTGGGCTTGGAGGGGAGGG + Intronic
1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG + Intronic
1184103713 22:42355311-42355333 GCACCCGGGCCTGCTGGAGAAGG - Intergenic
1184395423 22:44233380-44233402 ACACCAGGGCCTGTCGGGGCTGG - Intergenic
1184448562 22:44569313-44569335 ACAGCACGGCCTGCAGGGGATGG + Intergenic
1184500312 22:44867679-44867701 ACTCCAGGGCAAGCTGGAGAGGG + Intergenic
1184850071 22:47114989-47115011 CCTCCAGGGCCTGCTGGGCAGGG + Intronic
1184879724 22:47297239-47297261 AAACCAGGGCTGGGTGGGGGCGG - Intergenic
949203610 3:1411149-1411171 ACACCAGGGCCTGTTGGGGGTGG - Intergenic
949227104 3:1707051-1707073 ACACCACGGCCTGTTGGGGTCGG + Intergenic
950162081 3:10767865-10767887 ACACTAGGGCATGCTGGGGAAGG + Intergenic
951401139 3:22232545-22232567 ACACCAGGGCCTGTCAGGGATGG - Intronic
951424061 3:22521304-22521326 ACACCAGGGCCAGCTGGGGGAGG + Intergenic
951977308 3:28526962-28526984 ACACCAGGGCCTGTTGGGGGTGG - Intronic
952029658 3:29125954-29125976 ACACTGGGGCTTGTTGGGGGTGG - Intergenic
952721458 3:36537526-36537548 ACACTAGGGCCTGTTGGGGCAGG + Intronic
952943811 3:38462407-38462429 AAAACAGGGCTTGCTGGGGATGG - Intronic
953116729 3:40000010-40000032 ACACCAGGGCCTGTTGTGGGAGG + Intronic
953523433 3:43665358-43665380 ACACCAGGGCCTGTGGGGGGTGG + Intronic
954416114 3:50394240-50394262 GCCCCAGGGAGTGCTGGGGATGG - Intronic
954603414 3:51890520-51890542 ACTCCATGGATTGCAGGGGAGGG + Intergenic
954625892 3:52021674-52021696 AGGCCAGGCCTTGCTGGGGAGGG - Intergenic
954714726 3:52521351-52521373 CCGCCAGGGCAAGCTGGGGATGG - Exonic
954947685 3:54440643-54440665 ACACCAGGGCCTGTTGTGGGCGG - Intronic
955562736 3:60209918-60209940 ACAACAGGGCCTGTTGGGGGTGG + Intronic
955586671 3:60485636-60485658 ACACCAAGGCCTGTTGGGGGTGG + Intronic
955803244 3:62707317-62707339 AGACCCGGGGTTGCAGGGGATGG - Intronic
955942259 3:64157744-64157766 CCACCAGGAGTGGCTGGGGAGGG + Intronic
956453294 3:69395000-69395022 ACACCGGGGCTTGTCGGGGGTGG + Intronic
956584812 3:70852974-70852996 TCACCTGGGCGTGCTGGGGTGGG - Intergenic
957371135 3:79295433-79295455 ACACCAGGGCCTGTTGGGGGTGG + Intronic
957530237 3:81431511-81431533 ACACCAGGGCTTGTTGGGGGTGG + Intergenic
958260720 3:91377891-91377913 ACACCAGGGCCTGTTTGGGGGGG - Intergenic
959075228 3:101742573-101742595 ACACCAGGGCCTGTTGGGTGGGG + Intronic
959187102 3:103058093-103058115 ACACCAGGGCCTGTTGGGATGGG - Intergenic
959249304 3:103920901-103920923 ACACCAGGGATTACTAGGGTGGG + Intergenic
959349199 3:105239301-105239323 ACACCGGGGCCTGTCGGGGATGG - Intergenic
959765368 3:110020726-110020748 ACACTGGGGCCTGTTGGGGAGGG + Intergenic
960679576 3:120233325-120233347 ACACTGGGGCCTGTTGGGGAAGG - Intronic
960734064 3:120758578-120758600 ACACCAGGGCCTGTCGGGGGTGG - Intronic
960847513 3:122018375-122018397 ACACCAGGGCCTGTTGGGGTGGG + Intronic
960974211 3:123159430-123159452 GCTCCAGGGGGTGCTGGGGAAGG + Intronic
961453442 3:127012987-127013009 TCCCCAGGGCTTCCAGGGGATGG - Intronic
961686150 3:128632883-128632905 GCACGATGGCTTGCTGGGCACGG - Intronic
962211479 3:133482836-133482858 ACACCAGGACCTGTTGGGGTGGG + Intergenic
962700918 3:137999165-137999187 ACGACAGGGACTGCTGGGGAGGG + Intronic
962745025 3:138390602-138390624 ACTCCAGGGCTTCCTGGGGGAGG - Intronic
962929629 3:140024371-140024393 AGTCCAGGGCTCCCTGGGGAAGG - Intronic
963048020 3:141117660-141117682 ACACCAGGGCCTGTTGGGCGGGG - Intronic
963931294 3:151006644-151006666 ACACCAGGGCCTGTGGGGGGTGG - Intergenic
964266568 3:154903614-154903636 ACACCAGGGCCTATTGGGGGGGG + Intergenic
964377435 3:156063069-156063091 ACACCAGGGCCTGTCGGGGGTGG - Intronic
964460022 3:156914320-156914342 ACACCAGGGCCTGTTGAGGGTGG - Intronic
964672161 3:159238627-159238649 TCACCAGAGGTTGCTGAGGAAGG + Intronic
965256371 3:166418629-166418651 ACACTGGGGCCTGCTGGGGCAGG - Intergenic
965271626 3:166623408-166623430 ACACCAGGGCCTGCTGGGGGTGG + Intergenic
965802870 3:172512532-172512554 GCATCAGGGCTTGCGGTGGAGGG - Intronic
965853101 3:173054618-173054640 ACACCAGGGCCTATTGGGGGTGG + Intronic
966117853 3:176486326-176486348 ATACCAGGGCCTGTTGGGGGTGG - Intergenic
966532687 3:180998337-180998359 ACACCAGGGCCTGTCGGGGGGGG - Intergenic
967715014 3:192752741-192752763 ACACCAGAGCCTGCTGGGGGTGG + Intronic
968478495 4:823947-823969 GGACCAGGGCTTGCTGGTTACGG - Intronic
968695934 4:2026678-2026700 ACACTGGGGCCTGCTGGGGGAGG - Intronic
968805148 4:2767417-2767439 ATATCAGGGGTTGCTGGGGGTGG + Intergenic
968859035 4:3151699-3151721 AAACCAGGGTTGGCGGGGGATGG - Intronic
969047285 4:4345638-4345660 ACACCGGGGCCTGTTGGGGGTGG - Intergenic
969100099 4:4762415-4762437 AAACCAGGGCTGGCTATGGAAGG + Intergenic
970383834 4:15536292-15536314 ACACCAGGGCCTGTCGGGGGTGG + Intronic
970654839 4:18219466-18219488 ACACCAGGGTCTGTTGGGGGTGG - Intergenic
970776460 4:19680047-19680069 ACACTGGGGCTTGTTGGGGGTGG - Intergenic
970862132 4:20716490-20716512 ACACCAGGGCCTGTCGGGGGAGG - Intronic
971310957 4:25525426-25525448 ACACCATGGCCTGCTGGGCGCGG - Intergenic
971428665 4:26541112-26541134 ACACCAGGGCCTGTCGGGGTGGG + Intergenic
971602046 4:28605412-28605434 ACACCAGGGCCTGTCGGGGTTGG + Intergenic
971873988 4:32280733-32280755 ACACCAGAGCCTTCTGGGGGTGG + Intergenic
972253326 4:37328401-37328423 ACACTGGGGCCTGCTGGGGGTGG - Intronic
972463602 4:39330072-39330094 AGACTAGGTCTTGGTGGGGATGG + Intronic
973561769 4:52144145-52144167 CCACCAGGGGTTACTGGGGAGGG - Intergenic
973799809 4:54466092-54466114 ACACCAGGGCTTGTTGGGGGTGG + Intergenic
974106234 4:57472712-57472734 ACACTGGAGCTTGTTGGGGAGGG - Intergenic
974302061 4:60081580-60081602 ACACTCGAGCTTGGTGGGGAAGG + Intergenic
974760910 4:66272199-66272221 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
974769188 4:66388555-66388577 ACACCAGAGCCTGTTGGGGGTGG + Intergenic
975219734 4:71800238-71800260 ACACCGGGGCCTGCCAGGGAGGG - Intronic
975526009 4:75351265-75351287 ACATCAGGGCCTGTTGGGTAGGG - Intergenic
975616433 4:76251881-76251903 AGACCCGCGCTTGCTGGGGCGGG + Intronic
975657113 4:76652672-76652694 AGACCAGGCCTTCCTGGAGAGGG + Intronic
975999097 4:80350767-80350789 ACACCCGGGCCTGTTGGGGGTGG + Intronic
976076639 4:81306545-81306567 ACACCAGGGCCTGTCGGGGGTGG - Intergenic
976477424 4:85500877-85500899 ACACCAGGGCCTGTTGGTGGGGG - Intronic
976549127 4:86374241-86374263 ACACCAGGGCCTGTTGGGGGTGG + Intronic
977087241 4:92617381-92617403 ACAGCAGGGCCTGTCGGGGATGG - Intronic
977445662 4:97128642-97128664 ACACCTGGGGCTGTTGGGGAAGG + Intergenic
977462524 4:97342851-97342873 ACACCAGGGCCTGTTGGTGGCGG + Intronic
978243718 4:106548350-106548372 ACACCAGGGCTACCTCAGGATGG + Intergenic
978611187 4:110542325-110542347 TCACCAGGGCAGCCTGGGGAGGG - Intronic
978629720 4:110730334-110730356 ACACCAGGGCCTGTCGGGGTGGG - Intergenic
979037918 4:115748849-115748871 ACACCAGGGCCTGCTCGGGGTGG - Intergenic
979136614 4:117118286-117118308 ACACCATGGCCTCCTTGGGAAGG - Intergenic
979641177 4:123013580-123013602 ACACCAGGGCCTGTCGGGGTTGG + Intronic
980317104 4:131216568-131216590 ACACAAGGGCCTGTTGGGGTTGG - Intergenic
980364064 4:131776512-131776534 ACACCAGGGCCTGTTGGGGGTGG - Intergenic
980499030 4:133624953-133624975 AGGCCAGGGCTTGCTGAGCATGG + Intergenic
980804091 4:137789626-137789648 ACACCGGGGCCTGTGGGGGATGG + Intergenic
981041767 4:140229777-140229799 ACACCAGGGCCTGTTGGTCAGGG - Intergenic
983478493 4:168244088-168244110 ATACCAGGGCCTGTTGGGGCAGG + Intronic
983963145 4:173778497-173778519 ACACCACGGCAGGCAGGGGAGGG - Intergenic
984136109 4:175941549-175941571 ACACCAGGGCCTGTTGCGGGAGG - Intronic
984538200 4:181003199-181003221 ACACCAGGGCCTGTCGGGGGGGG + Intergenic
984558725 4:181243006-181243028 ACACCAGGGCCTGTTGGGGGCGG + Intergenic
984985054 4:185320460-185320482 ACACCAGGGCCTATTGGGGGTGG + Intronic
985179783 4:187246183-187246205 ACACCAGGGTTTAATGGGGTGGG + Intergenic
985539778 5:482519-482541 ACCCCAGGGCTGGCTGGGCTGGG + Intronic
985587519 5:748628-748650 AGACCAGAGCTTGCTGGGGATGG + Intronic
985602077 5:840719-840741 AGACCAGAGCGTGCTGGGGATGG + Intronic
985767764 5:1789084-1789106 GCACCAGGGTTGGCTGGTGAGGG + Intergenic
985824421 5:2181905-2181927 GCACGAGGTCCTGCTGGGGAAGG - Intergenic
986432819 5:7698544-7698566 ATACCAGGGCCTGTTGGGGAGGG - Intronic
986614950 5:9606562-9606584 AAATCAGGGATTGCTGGGGCAGG - Intergenic
986722841 5:10572343-10572365 TCAGCAGGTCTTGGTGGGGAGGG - Intronic
987813739 5:22873541-22873563 AGTCCAGGGCTTTCTGGTGATGG - Intergenic
988163892 5:27558226-27558248 ACACTAGGGTCTGTTGGGGATGG + Intergenic
988393991 5:30673784-30673806 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
988611531 5:32731451-32731473 AAACTAAGGCTTGCAGGGGAGGG - Intronic
989122364 5:38017436-38017458 ACAGCAGGGAATGCTGAGGAGGG + Intergenic
989138764 5:38181656-38181678 ACACCGGGGCCTGTTGGGGGTGG + Intergenic
989366549 5:40662466-40662488 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
989672115 5:43930928-43930950 ACACCAGGGCCTGTTGAGGGTGG - Intergenic
992365904 5:76089185-76089207 ACACTGGGGCCTGTTGGGGAGGG - Intronic
992814833 5:80426453-80426475 ACACTGGGGCCTGCTGGGGTGGG - Intronic
993048777 5:82899925-82899947 ACACTAGGGCCTGCGGGGGGTGG + Intergenic
993316318 5:86410894-86410916 ACACCAGGGCCTGTTGGGGGCGG - Intergenic
993815693 5:92542395-92542417 ACACCAGGGCCTGTTGGGGTTGG + Intergenic
994113746 5:96038528-96038550 ACACCAGGGCCTGCGGGGGGTGG - Intergenic
994161479 5:96561547-96561569 ACACCGGGGCCTGTTGGGGGTGG + Intronic
995295112 5:110511278-110511300 ACACCAGGGCCTGGTGGGGGTGG + Intronic
995664882 5:114530804-114530826 ACACCAGGGCCTGTTGGGGGTGG - Intergenic
996204461 5:120714972-120714994 ACACCAGGGCCTGTTGGTGGTGG + Intergenic
996854407 5:127988934-127988956 ACACCAGGGCCTGTCGGGGTGGG - Intergenic
997162051 5:131619298-131619320 ACACCAGGGCCTGTTGCGGCGGG + Intronic
998954308 5:147422838-147422860 ACACCAGGGCCTGTTGGGGGTGG + Intronic
999748019 5:154607079-154607101 GACCCAGGGCTTGGTGGGGACGG - Intergenic
1000517174 5:162252511-162252533 ACACTGGGGCCTGTTGGGGATGG + Intergenic
1000895367 5:166848590-166848612 ACACCAGGGCCTGTTGGGGTTGG + Intergenic
1001049536 5:168403385-168403407 ACAACAGAGCTGGCTGGGCACGG - Intronic
1002402447 5:178998679-178998701 ACACTGTGGCTTGCTGGGAATGG - Intergenic
1002756145 6:162011-162033 ACACCAGGACCTGCAGGGGGTGG + Intergenic
1002792135 6:444626-444648 AGACAAGGGCGTGCAGGGGAAGG - Intergenic
1004057470 6:12154624-12154646 ACACCAGGGTCTGTTGGGGGTGG + Intronic
1004279179 6:14265983-14266005 ACATCAGGGTTTGCTGAGGGTGG - Intergenic
1004799001 6:19124719-19124741 ACACCGGGGCCTGTTGGGGGTGG + Intergenic
1005147642 6:22709699-22709721 ACAGAAGGGCCTGCTGGAGAGGG + Intergenic
1006011226 6:31044608-31044630 AGACCAGGGTTTACAGGGGATGG - Intergenic
1006509804 6:34515701-34515723 GACCCTGGGCTTGCTGGGGATGG - Intronic
1006518076 6:34555676-34555698 ACCCCAGGCCTTGCCGGGCAAGG + Intronic
1006735881 6:36272046-36272068 ACACCAGGGTTGGTGGGGGATGG + Intronic
1007246115 6:40464177-40464199 ACACCAGTCCTTGCTTTGGAGGG - Intronic
1007548548 6:42711575-42711597 AGACCAGGGCTCCCTGAGGATGG - Intronic
1007561110 6:42809105-42809127 ACACCGGGGCCTGTTGGGGGGGG - Intronic
1007846576 6:44762939-44762961 ACACCAGGGCCTACTGGGGGAGG - Intergenic
1008994445 6:57642214-57642236 ACACCAGGGCCTGTTTGGGGGGG + Intronic
1009717732 6:67422601-67422623 ACACCAGGGCCTGTTGGGGTTGG - Intergenic
1009754610 6:67920377-67920399 ACACCAGGACCTGTTGGGGGTGG + Intergenic
1009884370 6:69607079-69607101 ATACCAGGGCCTGTTGGGGGTGG + Intergenic
1009940386 6:70282528-70282550 ACAGCAGGCCTTGCTGGAAAAGG - Intronic
1010285063 6:74067405-74067427 ACACCGGGGACTGCTGGAGAGGG - Intergenic
1010846813 6:80719959-80719981 ACACCAGTGCTGGGTTGGGATGG - Intergenic
1011161585 6:84396846-84396868 ACACCGGGGCCTGCTGGGGGTGG + Intergenic
1011288283 6:85748419-85748441 ACACCAGGGCCTGTCGGGGGTGG - Intergenic
1011303674 6:85903188-85903210 ACACCGGGGCCTGTTGGGGGTGG - Intergenic
1011334304 6:86242981-86243003 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
1011458834 6:87581759-87581781 ACACCAGCGTTTGTTGGGGGTGG - Intronic
1012587376 6:100940351-100940373 ACACCGGGGCTGGCTGGAGGAGG - Intergenic
1012590606 6:100975363-100975385 ACACCGGGGCTGGCTGGGGGAGG + Intergenic
1012878958 6:104762534-104762556 GCACCAGGGCCTGCTGAGGGTGG + Intronic
1013616838 6:111851169-111851191 ACAGCAGAGGTGGCTGGGGAAGG + Intronic
1014178895 6:118361859-118361881 ACACCACCACATGCTGGGGAGGG + Intergenic
1014500335 6:122180890-122180912 CCACAGGGGCTTGCTGGTGATGG - Intergenic
1015014881 6:128400218-128400240 ACACCAGGGTTGGTTAGGGAAGG + Intronic
1015076239 6:129161660-129161682 ACACCAGGGCCTGCTTGAAAAGG - Intronic
1015162626 6:130170204-130170226 ACACCAGGGCCTGTTGGCGGTGG - Intronic
1016140157 6:140598524-140598546 ATACCAGGGCCTGCTGGGCGTGG + Intergenic
1016604791 6:145907923-145907945 ACACCAGGGCTTGTTGGGGCAGG - Intronic
1016981428 6:149858206-149858228 ACACCAGGGCCTGTCGGGGTGGG - Intronic
1017201507 6:151759616-151759638 GCTGCAGGGCATGCTGGGGAAGG - Intronic
1017310143 6:152966515-152966537 ACACCAGGGCCTGTTGGGGCTGG - Intergenic
1017639532 6:156477816-156477838 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
1018672148 6:166188113-166188135 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
1019570660 7:1710481-1710503 TCACCAGGACTTGGTAGGGAGGG + Intronic
1019706085 7:2497943-2497965 GCCCCAGGGTCTGCTGGGGAAGG + Intergenic
1019831651 7:3336509-3336531 CCACCAGGGGATGATGGGGATGG - Intronic
1020168629 7:5827509-5827531 ACCCCAAGGCTAGCTGGGCACGG + Intergenic
1020690848 7:11353047-11353069 ACACCCAGGCTTCCAGGGGATGG - Intergenic
1021401958 7:20219658-20219680 ACAAAAGGGCTGGCTGGTGAAGG + Intergenic
1022441536 7:30437208-30437230 ACACCAGGGCCTGTTGGGGGTGG + Intronic
1022467354 7:30660762-30660784 CCACCAAGGCTTTCTGGGAAGGG - Intronic
1022967003 7:35483177-35483199 AGACCAGTCCTTGCTGGGGAAGG + Intergenic
1023369135 7:39495356-39495378 ACACCAGGGCCTGTTGTGGCGGG - Intergenic
1023496459 7:40802555-40802577 TCACTAGGCTTTGCTGGGGAAGG - Intronic
1024430809 7:49285893-49285915 ACACCAGGACTTACTGAGGAAGG + Intergenic
1024577656 7:50777899-50777921 ACACCAGGGCCTGTCAGGGAGGG + Intronic
1025502684 7:61324508-61324530 ACACCGGGGACTGCTGGGGCTGG + Intergenic
1025517554 7:61670730-61670752 ACACCGGGGACTGCTGGGGCTGG + Intergenic
1025541877 7:62099380-62099402 ACACCGGGGACTGCTGGGGCTGG + Intergenic
1026052498 7:66959080-66959102 ACCCCAGCACCTGCTGGGGAGGG - Intergenic
1026446434 7:70488506-70488528 ACACCAGGGCTTGGAGGTTAGGG - Intronic
1026643455 7:72147932-72147954 ACACCAGGGCCTGTTGTGGGGGG + Intronic
1026885766 7:73943497-73943519 ACTCCTGGGCTGGCTGGGGCTGG - Intergenic
1027134034 7:75611793-75611815 ACACGAGGGCCTGCTGGGTCAGG - Intronic
1027270650 7:76516719-76516741 GCTCAAGGGCTTGCTTGGGAGGG - Intergenic
1027375213 7:77541236-77541258 TCAGCAGGGCTTGGTGGGGTGGG - Intronic
1027601814 7:80248802-80248824 AAGCCAGGGCCTGATGGGGAAGG - Intergenic
1028139517 7:87258014-87258036 ACACTGGGGCCTGTTGGGGAGGG - Intergenic
1028616647 7:92776067-92776089 ACACCAGGGCCTGTCGGGGTGGG - Intronic
1028828478 7:95301572-95301594 ACCCCAGGGCTAGCAAGGGAGGG - Intronic
1029193252 7:98786552-98786574 TCACCTGGCCTTGCTGGGGATGG + Intergenic
1030973488 7:116090950-116090972 ACACCAGGGCCTGTCGGGGGTGG + Intronic
1030998925 7:116392207-116392229 ACACCAGGGCCTGTCGGGGGTGG + Intronic
1031268431 7:119612337-119612359 ACACCAGGGCCTGTCGGGGGTGG + Intergenic
1031320642 7:120323153-120323175 ACACCAGGGCCTGTCGGGGGTGG - Intronic
1031744567 7:125477902-125477924 ACACCAGGGCCTGTCAGGGATGG - Intergenic
1033526102 7:142215285-142215307 ACACCAGGGCCTGTTGGGGGTGG + Intronic
1033546420 7:142405369-142405391 GCACTAGGGTTTGCTGGGGTTGG + Intergenic
1033547127 7:142411852-142411874 ACACCAGGGCCTGTTGGGGCGGG + Intergenic
1033584931 7:142767449-142767471 CCACCAGAGCCTGCTGGGAAGGG + Intergenic
1033586414 7:142778062-142778084 CCACCAGAGCCTGCTGGGAAGGG + Intergenic
1033717093 7:144013712-144013734 ACACCAGGGCCTGTCGGGGATGG + Intergenic
1034114653 7:148573594-148573616 ACACTAGGGCCTGTTGGGGGTGG - Intergenic
1034356885 7:150457943-150457965 AGGCCAGGGCCTGTTGGGGAAGG - Intronic
1035734137 8:1875244-1875266 ACACCAGGGCGTGTAGGGGGTGG + Intronic
1037801381 8:22037686-22037708 ACCCCAGAGGGTGCTGGGGAGGG - Intergenic
1038191462 8:25324803-25324825 ACACCAGGGCCTGTTGTGGCGGG - Intronic
1038692481 8:29775764-29775786 ACAACTGGGCTGGCTGGGAATGG - Intergenic
1038858938 8:31364570-31364592 ACACCAGGGCCTGTCGGGGATGG - Intergenic
1038882293 8:31628073-31628095 ACCCCTTGGATTGCTGGGGAGGG + Intergenic
1039036587 8:33366241-33366263 ACACCAGGGCCTGTCGGGGATGG + Intergenic
1039421067 8:37441227-37441249 ACACCACTGCTGCCTGGGGATGG + Intergenic
1039828337 8:41193646-41193668 ACACCAGGAATTGGTGGGGCAGG + Intergenic
1040322625 8:46326346-46326368 ACACCAGGGATTTCTGGGAAGGG + Intergenic
1040438474 8:47416782-47416804 ACACCAGGGCCTGTTGTGGGTGG - Intronic
1040446409 8:47499799-47499821 ACACCAGGGCCTGTTGTGGGTGG - Intronic
1041645507 8:60247412-60247434 ACACCATGGCCTGTTGGGGGTGG - Intronic
1042503319 8:69533410-69533432 ACACCAGGGCCCACTGGGGGAGG - Intronic
1043150232 8:76705886-76705908 ACACCAGGGCCTGGAGGAGACGG + Exonic
1043236171 8:77869855-77869877 ACACCAGGGCCTCTTGGGGGTGG + Intergenic
1043481275 8:80655175-80655197 ACACCAGGGCCTGTTGTGGGGGG + Intronic
1043747180 8:83889597-83889619 ACACCAGGGCCTGTTGGGGCTGG + Intergenic
1043748383 8:83904622-83904644 ACACCAGGGCCTGTTGGGGGCGG - Intergenic
1044040565 8:87363010-87363032 ACACCAGGGCCTGTTGGGTGGGG - Intronic
1044224188 8:89701091-89701113 TCACCAGTGGCTGCTGGGGAGGG - Intergenic
1044606200 8:94050196-94050218 ACACCAGGGACTGTTGGGGAGGG - Intergenic
1045432248 8:102124503-102124525 GCACCAGGGCAAGCGGGGGAGGG - Intronic
1045829747 8:106444671-106444693 CCACCAGGGATTGTTGGGGGTGG + Intronic
1045874288 8:106961203-106961225 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
1046129465 8:109948435-109948457 ACACCAGGGCTTGGTGGCAGGGG - Intergenic
1046341900 8:112869866-112869888 ACACCCGGGCCTGTTGGGGTGGG + Intronic
1046696040 8:117340624-117340646 TCACCAGAGCAAGCTGGGGAAGG + Intergenic
1047329510 8:123873696-123873718 CCACCAGGCATTGCTGGAGAGGG - Intronic
1047393744 8:124475076-124475098 ACACCAGGGCTCGGTGGGCCGGG - Exonic
1047508437 8:125497837-125497859 AGCCCAGAGCTTGCCGGGGATGG + Intergenic
1047706336 8:127503363-127503385 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
1047718932 8:127620696-127620718 TCGCCAGGGAATGCTGGGGAAGG + Intergenic
1048055645 8:130860797-130860819 ACACCGGGGCCTGTTGGGGGTGG - Intronic
1048314560 8:133352493-133352515 AGACCAGGGCAGGTTGGGGAAGG + Intergenic
1048373233 8:133798779-133798801 ACACCCGGGCTTTTTGGGGTTGG + Intergenic
1048409419 8:134156600-134156622 ACACCAGGCCGGGCTGGTGAAGG - Intergenic
1048448969 8:134514965-134514987 ACACCAGGGCCTGTTGGGGGTGG - Intronic
1049030934 8:140037002-140037024 ACACCAGGGCCTGTCGGGGGTGG - Intronic
1049566838 8:143344679-143344701 ACAACAGGGGTTACTGGGGAGGG - Intronic
1049629784 8:143647450-143647472 ACAGCAAGGCTGGCTGGGCATGG - Intronic
1050628821 9:7537297-7537319 ACACCAGGGCCTGTTGGGGGTGG - Intergenic
1050663249 9:7906919-7906941 AAAACTGGGTTTGCTGGGGATGG - Intergenic
1051438246 9:17055296-17055318 ACACCAGGCCCTGTTGGGGGTGG - Intergenic
1051492524 9:17682540-17682562 GCACCAGGGCCTGTTGTGGAGGG + Intronic
1051734300 9:20182619-20182641 ACACCAGGGCCTGTCGGGGCGGG + Intergenic
1052342245 9:27375239-27375261 ACTCCAGTGCTTGCTGGGGCTGG - Intronic
1052380712 9:27767846-27767868 ACACCAGGGCCTGTCGGGGTTGG + Intergenic
1052596923 9:30573287-30573309 ACACCAGGGCCTGTCGGGGGTGG + Intergenic
1052768955 9:32670070-32670092 ACACCAGGGCTTGTTGGGGGTGG + Intergenic
1052814579 9:33091390-33091412 ACACCAGGGCCTGTTGGGGGTGG + Intergenic
1052902170 9:33802718-33802740 CCACCAGAGCCTGCTGGGAAGGG + Intergenic
1052956993 9:34260678-34260700 ATAACAGAGCTGGCTGGGGACGG + Intronic
1053471460 9:38348541-38348563 ACATTAGTGGTTGCTGGGGAGGG + Intergenic
1054403158 9:64732384-64732406 ACACCAGGGCCTGTTGTGGGGGG - Intergenic
1054802856 9:69368987-69369009 ACACCAGGGCCTGCCGAGGGTGG - Intronic
1054871047 9:70047359-70047381 ACACCGGGGCCTGTTGGGGGTGG - Intronic
1055494772 9:76843308-76843330 ACACCGGGGCCTGTTGGGGATGG + Intronic
1056506455 9:87262817-87262839 ACATTGGGGCCTGCTGGGGAGGG + Intergenic
1057920217 9:99091149-99091171 AGACCAGAGCCTGCTGGGGAGGG + Intergenic
1058105548 9:100967084-100967106 ACACCAGGGCCTGTCGGGGGTGG - Intergenic
1058121500 9:101144250-101144272 ACACCGGGGCCTGTTGGGGGTGG + Intronic
1058183098 9:101821808-101821830 ACTCTGGGGCTTGTTGGGGATGG + Intergenic
1058319827 9:103615027-103615049 GCATCAGGGCTTACTGGGGTGGG + Intergenic
1058507963 9:105685916-105685938 ACACCAGGGCCTGTCGGGGGTGG + Intergenic
1058542021 9:106021364-106021386 ACACCAGGGCCTGTTGGGGAAGG + Intergenic
1058934947 9:109761531-109761553 ACACCAGGGCCTGTTGGGGGTGG - Intronic
1059089678 9:111342381-111342403 ACACCGGGGCCTGTTGGGGGTGG + Intergenic
1059895668 9:118861585-118861607 ACACTGGGGCTTGTTGGGGGTGG + Intergenic
1060029190 9:120199572-120199594 ACACCAGGGCCTGCTGTCGGTGG - Intergenic
1060056688 9:120420194-120420216 ACAGCATGGCTTACAGGGGAGGG + Intronic
1060094773 9:120778397-120778419 ACACTGTGGCTTGCTGGGAATGG - Exonic
1060572730 9:124657743-124657765 ACATTAGGGGTTGCTGGGGGGGG - Intronic
1061160726 9:128892476-128892498 ACGCCAGGGCTGGAGGGGGAGGG - Intronic
1061228483 9:129296255-129296277 ACACCAGGGCCTGTGGGGGGTGG - Intergenic
1061844538 9:133379660-133379682 TCACCAGGGCTAGCAGGGCATGG + Intronic
1062146385 9:134992097-134992119 GCAACTGGGCATGCTGGGGAAGG + Intergenic
1062340746 9:136092968-136092990 AGAACAGGGCTGGCTGAGGAAGG + Intronic
1062433213 9:136535137-136535159 ACACCAGGGCTCTGTGGGGCGGG - Intronic
1062729317 9:138100377-138100399 CCACCTGGGCTTGATGGGCAGGG + Intronic
1186333180 X:8558156-8558178 ACACCAGGGCCTGTTGGGGGTGG + Intronic
1186631699 X:11356247-11356269 ACACCGGGGCCTGTTGGGGGTGG + Intronic
1187719309 X:22134796-22134818 AACCCAGGCCTTGCTGGGAAGGG - Intronic
1188363720 X:29288317-29288339 ACACTGGGGCCTGCTGGGGCTGG - Intronic
1188495806 X:30781830-30781852 ACACTGGGGCCTGCAGGGGATGG - Intergenic
1189858054 X:45243407-45243429 ACACCAGGGACTGTTGGGGGTGG - Intergenic
1189911310 X:45813050-45813072 ACACCAGGGCCTACTGGGGGTGG - Intergenic
1189942040 X:46134630-46134652 ACACCAGGGCCTGTAGGGGGTGG + Intergenic
1190515598 X:51220788-51220810 ACACCCGGGCCTGTTGGGGTGGG + Intergenic
1190929149 X:54933719-54933741 ACACCCAGGCTTGGTGGGGTTGG + Intronic
1191752053 X:64553400-64553422 ACACCAGGGCCTGTTGGTGGGGG + Intergenic
1191776449 X:64819759-64819781 ACACCAGGGCCTATTGGGAAGGG + Intergenic
1192123413 X:68477696-68477718 ACTCCAGGGCTGGCTGGTGCCGG + Intergenic
1192292272 X:69810464-69810486 AAACCTGGGCTGGCTGGGCACGG + Intronic
1192540348 X:71964220-71964242 ACACCAGGGCCTGTTGGGGGTGG - Intergenic
1192720492 X:73691744-73691766 ACACCAGGGCCTGTCGGGGCAGG - Intergenic
1192952619 X:76033391-76033413 ACACTGGGCCTTGCAGGGGATGG - Intergenic
1193091675 X:77500540-77500562 ACACCAGGGCCTGTAGGGGTTGG + Intergenic
1193191942 X:78581389-78581411 ACACCAGGGCCTGTCGGGGTGGG + Intergenic
1193201574 X:78697672-78697694 ACACCAGGGCGTGTTGGAGGTGG + Intergenic
1193272365 X:79544376-79544398 ACATCAGGGCTTGCTGCCCAGGG - Intergenic
1193318914 X:80097459-80097481 ACACCAGGGCCTGTTGGGTGGGG + Intergenic
1193803277 X:85963183-85963205 ACACCAGGGCCTGTCGGGGTTGG - Intronic
1193975279 X:88110761-88110783 ATACTGGGGCTTGTTGGGGAGGG - Intergenic
1194222806 X:91216526-91216548 ACACCAGGGCCTGTCGGGGTTGG - Intergenic
1194629122 X:96261703-96261725 ACACCAGGGCCTGTTGTGGGGGG + Intergenic
1194970746 X:100340682-100340704 ACACTTGGGTCTGCTGGGGAGGG + Intronic
1195102699 X:101570915-101570937 ACACCAGGGCCTGTTGGGGTTGG + Intergenic
1195127729 X:101824522-101824544 CCACCAGAGCTTTCTGAGGAAGG - Intergenic
1195425501 X:104725041-104725063 ACACCAGGGCCTGTCGGGGTTGG - Intronic
1195454452 X:105051851-105051873 ACACCAGGGCCTGTTGAGGGTGG + Intronic
1195532832 X:105976620-105976642 ACACCAGGGTCTGTTGAGGAAGG - Intergenic
1195685694 X:107583245-107583267 ACACCTGGGCCTGTTGGGGGTGG - Intronic
1195808836 X:108806339-108806361 ACACCAGGGCCTGTTGAGGATGG + Intergenic
1195978598 X:110554610-110554632 ACACCAGGGCCTGTTGGTGGGGG - Intergenic
1196019061 X:110970581-110970603 ACACCAGGGCCTGCTGTGGGTGG + Intronic
1196095311 X:111792291-111792313 ATACCAGGGCCTGTTGGGGTCGG + Intronic
1196159561 X:112467796-112467818 ACACCAGGGCCTGTGGGGGGTGG + Intergenic
1196536385 X:116850322-116850344 ACACCGGGGCCTGTTGGGGGTGG - Intergenic
1196870103 X:120105048-120105070 ACACCAGGGCTTGTCGGGGGTGG + Intergenic
1197680223 X:129374876-129374898 ACACCAGGGCCTGTTGGGGGTGG - Intergenic
1198953791 X:142104200-142104222 ACAGCAAGGTTTGCAGGGGATGG - Intergenic
1199021593 X:142884703-142884725 ACACCAGGGCCTGTCGGGGGTGG + Intergenic
1199409129 X:147499311-147499333 ACACCGGGGCCTGTTGGGGTAGG - Intergenic
1199491718 X:148407330-148407352 ACACCAGGGACTGTTGTGGAGGG + Intergenic
1199788284 X:151125757-151125779 ATACCAGGGCCTGTTGGGGGTGG + Intergenic
1200268073 X:154656947-154656969 ACACCGGGGCCTGTTGGGGGTGG + Intergenic
1200692983 Y:6326963-6326985 ACACCAGGGCCTGCCAGGGGTGG + Intergenic
1200707797 Y:6457563-6457585 ACACCAGGCCATGGTGTGGATGG + Intergenic
1200759645 Y:7026168-7026190 AAACCCAGGCTTGATGGGGAGGG - Intronic
1200760636 Y:7035782-7035804 ACACCAGGGCCTGTTGGGGTGGG + Intronic
1201021462 Y:9662228-9662250 ACACCAGTGCCTGTTGGGGGTGG + Intergenic
1201026315 Y:9707145-9707167 ACACCAGGCCATGGTGTGGATGG - Intergenic
1201042289 Y:9847763-9847785 ACACCAGGGCCTGCCAGGGGTGG - Intergenic
1201428922 Y:13885672-13885694 ACAGTAGGGCCCGCTGGGGATGG + Intergenic
1201933570 Y:19380968-19380990 ACACCTGGGCCTGTTGGGGTTGG - Intergenic
1202085940 Y:21136813-21136835 ACACCAGGTCCTGTTGGGGGTGG - Intergenic