ID: 903361232

View in Genome Browser
Species Human (GRCh38)
Location 1:22778684-22778706
Sequence CAGAAGGACTGGAAGTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 271}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903361232_903361242 11 Left 903361232 1:22778684-22778706 CCCATTTACTTCCAGTCCTTCTG 0: 1
1: 0
2: 1
3: 15
4: 271
Right 903361242 1:22778718-22778740 CTGCTTTGGGCCACTGCTTTGGG 0: 1
1: 0
2: 2
3: 25
4: 258
903361232_903361245 21 Left 903361232 1:22778684-22778706 CCCATTTACTTCCAGTCCTTCTG 0: 1
1: 0
2: 1
3: 15
4: 271
Right 903361245 1:22778728-22778750 CCACTGCTTTGGGCCAGGAGAGG 0: 1
1: 0
2: 4
3: 40
4: 327
903361232_903361243 16 Left 903361232 1:22778684-22778706 CCCATTTACTTCCAGTCCTTCTG 0: 1
1: 0
2: 1
3: 15
4: 271
Right 903361243 1:22778723-22778745 TTGGGCCACTGCTTTGGGCCAGG 0: 1
1: 0
2: 1
3: 39
4: 419
903361232_903361236 -3 Left 903361232 1:22778684-22778706 CCCATTTACTTCCAGTCCTTCTG 0: 1
1: 0
2: 1
3: 15
4: 271
Right 903361236 1:22778704-22778726 CTGAGATCCTCCCACTGCTTTGG 0: 1
1: 0
2: 5
3: 31
4: 233
903361232_903361237 -2 Left 903361232 1:22778684-22778706 CCCATTTACTTCCAGTCCTTCTG 0: 1
1: 0
2: 1
3: 15
4: 271
Right 903361237 1:22778705-22778727 TGAGATCCTCCCACTGCTTTGGG 0: 1
1: 0
2: 1
3: 14
4: 165
903361232_903361241 10 Left 903361232 1:22778684-22778706 CCCATTTACTTCCAGTCCTTCTG 0: 1
1: 0
2: 1
3: 15
4: 271
Right 903361241 1:22778717-22778739 ACTGCTTTGGGCCACTGCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903361232 Original CRISPR CAGAAGGACTGGAAGTAAAT GGG (reversed) Intronic
901928509 1:12582494-12582516 CAGATGGACTGCAATTAAACAGG + Intronic
903361232 1:22778684-22778706 CAGAAGGACTGGAAGTAAATGGG - Intronic
905905385 1:41614694-41614716 CAGAAGGGATGGAAGAAGATGGG + Intronic
907959289 1:59263614-59263636 CAGAAAGACTAGAAGTAGGTTGG - Intergenic
908010503 1:59771706-59771728 CACAAGGAGGGGAAGTAAGTTGG - Intergenic
909476092 1:76082351-76082373 CAGAATGGCTGGAGGCAAATGGG - Intronic
909498409 1:76305388-76305410 CAGAAGGAGTGGAACTAGAGAGG + Intronic
914942131 1:152032609-152032631 CAGAAAGGCTGGAAGGAAAGGGG + Exonic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916339143 1:163709170-163709192 CAGAAGCAGTGGAAGTCAGTAGG - Intergenic
917074783 1:171193015-171193037 CACAAAGACTGGCATTAAATAGG + Intronic
917164557 1:172097624-172097646 AAGAAGAACTGGAACTGAATGGG + Intronic
920131189 1:203733109-203733131 AAGCAGGAATGGAAGTAGATGGG - Intronic
920761463 1:208787157-208787179 AAGAAAGAATGGCAGTAAATGGG - Intergenic
920761596 1:208788332-208788354 CAGAAGGAAGGGATGCAAATAGG - Intergenic
921668510 1:217901217-217901239 CAGAAGGACTGGAAGTGGGGAGG + Intergenic
922352665 1:224747043-224747065 CAGAAGTACTGTAAAGAAATAGG + Intergenic
922690763 1:227687988-227688010 CAAAAGGAGTGGAATCAAATTGG + Intergenic
922936507 1:229426898-229426920 TAGAAGGACTGCAGGGAAATGGG - Intergenic
1062780920 10:206638-206660 CAGAAAGACTGAAAACAAATGGG - Intronic
1063951839 10:11230537-11230559 CAGAATGTCTGGAAGGAAACAGG - Intronic
1066071719 10:31822358-31822380 CAGAAGGACTTGATGGAAAAGGG + Intronic
1066468074 10:35670734-35670756 CAGAAGAAATGGTAGTAATTGGG + Intergenic
1067911067 10:50347508-50347530 CAGAAGGTCAGGAAGAAAAGGGG + Intronic
1069163344 10:65117608-65117630 CAAAAAGACTGAAATTAAATTGG - Intergenic
1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG + Intergenic
1070543613 10:77435513-77435535 TAGAAAGACTGGAAGAAAACTGG + Intronic
1071075352 10:81744540-81744562 AAGAACTACTGTAAGTAAATAGG + Intergenic
1073837262 10:107458745-107458767 CAGAAGCACTAGCAGTAAGTAGG + Intergenic
1074485524 10:113873894-113873916 CAGAAAGACTAAAAGTAAAGGGG - Intronic
1078156632 11:8805556-8805578 CTGAAGGACTGGAAGTAGGAGGG - Intronic
1078317622 11:10305864-10305886 CCGAAGGTCTAGAAGTGAATGGG + Intronic
1078971961 11:16424527-16424549 TAGAGGGAATGGAAGTAAAAAGG + Intronic
1079419711 11:20274549-20274571 CAGAAGTACTGTATGTAAAATGG - Intergenic
1079675732 11:23224140-23224162 CAGGAGGAGTGGGTGTAAATAGG - Intergenic
1081929950 11:46862454-46862476 CAGAAGAACTGAATGTAATTTGG - Intronic
1081988405 11:47324367-47324389 CAGAAGGACTGGTAGAAACAGGG - Intronic
1082288360 11:50340726-50340748 TAGAAAAACTGGAATTAAATTGG - Intergenic
1082808895 11:57466756-57466778 GAGAATGACTGGAAGTAACTTGG - Intronic
1084450924 11:69237214-69237236 CAGATAGATTGAAAGTAAATAGG + Intergenic
1084863508 11:72038122-72038144 CAAAAGGACTGCAAGTCTATAGG - Intronic
1085379643 11:76103013-76103035 CTGAAGGCCAGCAAGTAAATGGG - Intronic
1086262525 11:84957696-84957718 CACCAGGACTGGCAGAAAATTGG + Intronic
1086563648 11:88198335-88198357 CAGATAAACTGGAAATAAATGGG - Intergenic
1088108623 11:106234865-106234887 CAGAAGCACTTAAACTAAATAGG - Intergenic
1088979412 11:114848435-114848457 AAGAAAGACTGGAAGTTAAAAGG + Intergenic
1089230180 11:116967064-116967086 CAGAAAGACGGGAAATAACTTGG + Intronic
1089395702 11:118135457-118135479 GAGAGGGATTGGAAGTAGATGGG + Exonic
1090126229 11:124087882-124087904 CAAAAGGACTGGAAATTAATAGG - Intergenic
1091270703 11:134309893-134309915 CAGAAGGAAGGAAAGTAGATAGG - Intronic
1092104017 12:5908172-5908194 CAGAAGGAGTGGAATTTGATGGG - Intronic
1093771527 12:23023355-23023377 CAGAAGTAGTGTAAGAAAATGGG + Intergenic
1094865153 12:34523069-34523091 CAGAAAGAGTGGAAGTATACTGG - Intergenic
1095658449 12:44699307-44699329 TAGAATGTCTGGAAGTATATTGG - Intronic
1096196075 12:49649602-49649624 CAGAAGGACTGGAAGGGCAGGGG + Intronic
1098662229 12:73109920-73109942 CAAAAAGACTGGCAGAAAATAGG - Intergenic
1098824417 12:75275511-75275533 CAGAATGACTGGAAGAATGTGGG + Intergenic
1099064870 12:77963464-77963486 CAGAAGGACTAGAATTAAGTGGG + Intronic
1099140375 12:78966641-78966663 CTGAGGCACTGTAAGTAAATAGG - Intronic
1100868938 12:98889946-98889968 CAGAAGGAAAGGAATTAAAGAGG + Intronic
1101700237 12:107167077-107167099 CAGAGGGACAGGAAGTACAAAGG - Intergenic
1101748751 12:107565240-107565262 CTGCAGGACTTGAAGGAAATGGG + Intronic
1104347713 12:128016961-128016983 AAAAAGTACTGGAAGTAAGTAGG + Intergenic
1104420976 12:128634877-128634899 CAGAAGGAAAGGAAATAAAAGGG - Intronic
1108862800 13:54882636-54882658 CAGCAGGACTGACAATAAATCGG + Intergenic
1109327606 13:60887671-60887693 CAGAAGGATATGAAGTAAAAGGG + Intergenic
1110873989 13:80487233-80487255 CAGGAGGACTGGTAACAAATTGG + Intergenic
1111745401 13:92262127-92262149 GAGAAGTACTGGAAGGAAAAGGG - Intronic
1111769246 13:92575619-92575641 CTGAAAGACAGGAAGTTAATGGG - Intronic
1112294419 13:98174084-98174106 AAAAAAGACTGGAAGGAAATCGG + Intronic
1112386636 13:98946108-98946130 GAGAAGGCCTGGGAGTAAATGGG + Intronic
1113453735 13:110432347-110432369 CAAAAGGACAGCAAGTAAGTTGG + Exonic
1115497820 14:34024529-34024551 GAGAAGGGCTGGAAGGAAAGGGG - Intronic
1116602421 14:46943244-46943266 CAAAAAGACTGAAAGGAAATGGG - Intronic
1118889729 14:69898891-69898913 CAAAAGGACTTGTGGTAAATAGG + Intronic
1119742298 14:77021989-77022011 CAGAAGAAATGGAGGTAAAATGG + Intergenic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1120351331 14:83363032-83363054 TAGGAGGAATGGGAGTAAATTGG - Intergenic
1121042750 14:90762290-90762312 CAGAGGCACTGGTAGGAAATTGG - Intronic
1121108311 14:91295250-91295272 GAGAAGAACTGGAAGGAAAAAGG + Intronic
1121149993 14:91623932-91623954 CAGAAGAAATGAAAGAAAATGGG - Intronic
1125391575 15:39198376-39198398 CAGAAGGACTGGAAGTCCATGGG + Intergenic
1127207953 15:56740097-56740119 CACAAGGACTGGAAGTCCCTGGG + Intronic
1128881722 15:71249886-71249908 CAGCAGGAGTGGAAGGAAAGGGG - Intronic
1129902040 15:79158576-79158598 CAGAGGGACTGAAAGTAGAAAGG + Intergenic
1130199441 15:81811280-81811302 CAGAATTACTGGAAGTTAAGAGG - Intergenic
1130735723 15:86546575-86546597 CAAAAGGACTTCAAATAAATAGG + Intronic
1134565592 16:15249223-15249245 CAGAAGGACTTGAAGATAAGTGG + Intergenic
1134736903 16:16507475-16507497 CAGAAGGACTTGAAGATAAGTGG - Intergenic
1134930612 16:18204698-18204720 CAGAAGGACTTGAAGATAAGTGG + Intergenic
1135600916 16:23782562-23782584 CAGAAGTACATGAAGTAAAAAGG + Intergenic
1135963568 16:27017564-27017586 CAAAATGACTGAAAGAAAATTGG + Intergenic
1136849000 16:33599127-33599149 CAGGAGCACTGGAAGTAATGGGG + Intergenic
1136872585 16:33821290-33821312 CACAAGGACTAAAAGTGAATGGG + Intergenic
1137914081 16:52409759-52409781 AAAAAGGACTGGAAGAAAACTGG - Intergenic
1137948065 16:52753618-52753640 CAGGAGGAAAGGAAGCAAATAGG + Intergenic
1138176392 16:54901805-54901827 CAAAAGGACTTGCCGTAAATAGG - Intergenic
1138548850 16:57736106-57736128 CAGAAGGACAGGTAATGAATAGG + Intronic
1139838759 16:69861309-69861331 CATACGGCCTGGAAGTAGATTGG + Intronic
1140116130 16:72043161-72043183 CAGAAGGAATGGAATTTAAATGG - Intergenic
1140516094 16:75542956-75542978 AAGAAAGACTGAGAGTAAATGGG - Intronic
1140985598 16:80155647-80155669 CAAAAGCACTGGAAGTGAGTAGG - Intergenic
1141513449 16:84527191-84527213 CAGAGGGACTGGAAGGACTTTGG - Intronic
1141883762 16:86878191-86878213 CCCAAGGACAGGAAATAAATGGG - Intergenic
1203099587 16_KI270728v1_random:1294778-1294800 CACAAGGACTAAAAGTGAATGGG - Intergenic
1203110707 16_KI270728v1_random:1447777-1447799 CAGGAGCACTGGAAGTAATGGGG + Intergenic
1143228885 17:5334001-5334023 AAGAAGGAGTGGAAATTAATGGG + Intronic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1147687519 17:42295589-42295611 CAGATGGAATGGAAATAACTCGG - Intronic
1148864275 17:50620481-50620503 CAGAAGACCTGGAATTAAATGGG - Intronic
1149152333 17:53582709-53582731 CAGAGGGACTGCAAGTGAAATGG + Intergenic
1151182908 17:72342711-72342733 GGAAAGGACTGGAAGTAAAGGGG + Intergenic
1151995548 17:77606553-77606575 CAGGAGGACTGGAAACACATAGG - Intergenic
1153351703 18:4088247-4088269 GAGAAACACTGGAAGTATATTGG - Intronic
1153441221 18:5121895-5121917 CATATAGACTGGAAGTAAAGGGG + Intergenic
1154286118 18:13058476-13058498 CCTAAGGACTGGAAGTAGAGGGG - Intronic
1155255236 18:23991064-23991086 TAGAAGAGCTGCAAGTAAATTGG + Intergenic
1155665672 18:28305769-28305791 AAGAAACACTGGAATTAAATTGG + Intergenic
1156444093 18:37221838-37221860 CAGAAGGACTTGAAGAACCTAGG - Intronic
1156756095 18:40528283-40528305 CAGAAGGATTTGCACTAAATAGG - Intergenic
1158033709 18:52999083-52999105 CAAAGGGACTGAATGTAAATAGG + Intronic
1158339147 18:56446768-56446790 CAGAAGCACTGAAAGAAGATTGG + Intergenic
1158758939 18:60360982-60361004 GAGAAGGAAAGGAAGAAAATTGG - Intergenic
1159249339 18:65853554-65853576 CAGAGGGGCTGGTAGAAAATAGG + Intronic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1159654935 18:71022056-71022078 CAGAAGAACTTAAAGTAATTTGG - Intergenic
1162223918 19:9203909-9203931 CAAAAGGACTTGTAGCAAATTGG + Intergenic
1162543654 19:11314773-11314795 CAGAAGGAGGGGAAGAAAAGAGG + Intronic
1163987398 19:20966629-20966651 TAGAAAGACAGGAAGTAAAGTGG + Intergenic
1168534884 19:57160601-57160623 CTCCAGGACTGGAAGTAAAAAGG - Intronic
925322015 2:2978734-2978756 CAGATAGACTGAAAGTAAAGGGG + Intergenic
925372094 2:3353301-3353323 AATAAAGACTGGAAGGAAATAGG - Intronic
926138587 2:10355020-10355042 CAGAAGGACAGGAAGCAAAGTGG + Intronic
927003446 2:18823591-18823613 CAGGAGGAGTGGAAATACATGGG - Intergenic
929676832 2:43942272-43942294 CAGAAGGATTTGAAAGAAATGGG - Intronic
929803813 2:45127388-45127410 CAGAAGGACTAGATGTATATCGG - Intergenic
929949922 2:46400967-46400989 CTGATGGACTGGAAATAAATCGG + Intergenic
930430300 2:51266831-51266853 CAGAAGGACTTGTAGAAAACAGG + Intergenic
931464385 2:62473913-62473935 CAGAAAGAGTGGAAGTAAGAGGG + Intergenic
935694258 2:105757441-105757463 TAGGAGGGCTGGAAGTATATGGG + Intronic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
937013257 2:118580767-118580789 CAGAAGAGCTGGAAGGAACTAGG - Intergenic
937352179 2:121173111-121173133 CAGAAGTACGGGAAGTAAGAGGG + Intergenic
937767431 2:125678330-125678352 CATAAGGACTCCAAGTAAAGGGG - Intergenic
939561215 2:143734238-143734260 CTGAAGGTCAGTAAGTAAATTGG - Intronic
939820810 2:146954883-146954905 GAGAAAGACTGGTAGAAAATGGG + Intergenic
941000094 2:160193665-160193687 CAGAAGGAAAGGAGGAAAATAGG - Intronic
941600182 2:167533756-167533778 GAGAAGGACTGAAATTAAAAAGG - Intergenic
942303966 2:174588319-174588341 CAGAATGACAGAAAGTTAATCGG - Intronic
943491905 2:188564280-188564302 CACAAGGATTGGAAAGAAATAGG + Intronic
944678114 2:202051298-202051320 AAGAAGGAGAGGAAGTAAAATGG - Intergenic
945726764 2:213479313-213479335 AAGAGAGACTGGAAGTACATGGG - Intronic
947539183 2:230963165-230963187 TAGTAGGACCTGAAGTAAATCGG - Intergenic
948525837 2:238570293-238570315 CAAAAGGGATGGAAGAAAATGGG + Intergenic
1169494190 20:6098121-6098143 CAGCAGCCCTGGAAGTAAAATGG - Intronic
1170409607 20:16074498-16074520 GAGAAGGATTGCTAGTAAATTGG + Intergenic
1172590781 20:36116457-36116479 CAGGAGGAAAGGAAGGAAATGGG - Intronic
1175024833 20:55890926-55890948 CATAAGGTCAGGAAGTAATTGGG - Intergenic
1175582562 20:60111756-60111778 TAGAAGAACTTGAATTAAATTGG + Intergenic
1177638583 21:23817218-23817240 CATAGGGACTGGAAGTAGATTGG - Intergenic
1179079741 21:38159722-38159744 AAAGAGGACTGAAAGTAAATGGG - Intronic
1179390210 21:40981858-40981880 TAGTAGGACTGGAGGTAAATTGG - Intergenic
1183421718 22:37715662-37715684 CAGAAGGAAGGGAAGGGAATTGG - Intronic
1184183185 22:42845133-42845155 CAGAAGGAAGAGAAGTAACTAGG + Intronic
951412143 3:22378922-22378944 GTGAAGGACTGGGAGTAACTTGG - Intergenic
951666366 3:25128168-25128190 CAGAATCACTGCAAGTAACTGGG + Intergenic
952711864 3:36439690-36439712 CTGAAGGACTTGAAGTGAAGAGG + Intronic
952974712 3:38683821-38683843 CAGAAGGCCTGGAGTCAAATTGG + Intergenic
954396946 3:50298034-50298056 CAGAAGGCCAGCAAGTAGATTGG - Intronic
954894073 3:53960696-53960718 AAGAAGGACTGCAAGTCACTTGG + Intergenic
954897655 3:53990457-53990479 CTGTGGAACTGGAAGTAAATGGG + Intergenic
954995143 3:54874482-54874504 GGGAATGACTGGAAGTTAATAGG - Intronic
955794254 3:62619068-62619090 CAGAGGTTCTGTAAGTAAATGGG - Intronic
957343997 3:78939050-78939072 CAGAAAGATTGTTAGTAAATAGG - Intronic
958197613 3:90261983-90262005 CAGAAGGACTTTGAGTCAATTGG - Intergenic
958914891 3:100038578-100038600 TGTAGGGACTGGAAGTAAATAGG + Intronic
959370387 3:105517314-105517336 CAGAATGAGTGGCAGTAAGTTGG - Intronic
960871759 3:122257050-122257072 AAGAAGAAGTGGAAGAAAATGGG - Intronic
963542876 3:146616945-146616967 CAGAAGTAGAGGAAGAAAATAGG - Intergenic
963546150 3:146661019-146661041 AAGAAACACTGGAATTAAATTGG + Intergenic
963754393 3:149218922-149218944 AAAAAGGAGTGGAAATAAATGGG - Intronic
963891199 3:150637708-150637730 CAAAGGGACTTGAAGTAATTGGG + Intergenic
965932075 3:174056994-174057016 CAAAATGACTGGATGTAATTAGG - Intronic
966348039 3:179000733-179000755 AGGAAGGAGTAGAAGTAAATGGG - Intergenic
967267342 3:187702233-187702255 CGGCAGGACTGGGAGTAAACAGG + Exonic
968056966 3:195699139-195699161 GAGAAGGACTGGAAGAATCTTGG + Intergenic
969065641 4:4478385-4478407 CAGAAAGACTGGCAGTACAACGG + Intronic
970158817 4:13168746-13168768 CAGGATGAGTGGAAGAAAATGGG - Intergenic
972271168 4:37511803-37511825 CAGAACGACTGCAAGTGAAATGG - Intronic
972906065 4:43748745-43748767 CAGAATGGCAGGAAGAAAATGGG + Intergenic
974190282 4:58495234-58495256 CTGAAGGCCTGGGAATAAATGGG - Intergenic
975027585 4:69570929-69570951 CAGAAGAACTGCTCGTAAATTGG + Intergenic
975225392 4:71865434-71865456 CAGAATGACTCAAAGTAACTGGG + Intergenic
975360519 4:73464338-73464360 CACAGGGACAGAAAGTAAATGGG + Intergenic
976200195 4:82570376-82570398 AGCAAGGACTGGAAGTAAAGGGG - Intergenic
977213879 4:94255850-94255872 CAGAAAAACTGTAAGTAAAATGG - Intronic
978888119 4:113790373-113790395 AAGAAGGACTAGAAAGAAATGGG - Intergenic
982162203 4:152581516-152581538 GAGAAGGAGTGGAAGGAAAGTGG - Intergenic
983611846 4:169655173-169655195 CAGAAAGACTGAAAGTAAAGAGG - Intronic
984111731 4:175625332-175625354 AAGAATGAATGGAAATAAATTGG + Intergenic
984931498 4:184851581-184851603 CAGAAGAACTTGTAGAAAATAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986144713 5:5066461-5066483 CAGCAGGGCTGGGAGGAAATTGG + Intergenic
986646772 5:9924413-9924435 CTGAAGGCCTGAAAGTCAATAGG - Intergenic
988705841 5:33725268-33725290 AAGATGAACTGGAAGGAAATCGG - Intronic
990409387 5:55525733-55525755 CAGAAGGAAGGGAAGTACAGTGG + Intronic
990687329 5:58320253-58320275 CAGAAAGAGTGAAAGAAAATGGG + Intergenic
990805733 5:59659335-59659357 CACAAGAAGTGGAAGTAAACAGG + Intronic
995139420 5:108718463-108718485 CAGAAGGACTGCAATTCAAATGG - Intergenic
995175232 5:109168427-109168449 AAGGAGGGCTGAAAGTAAATTGG + Intronic
998802504 5:145884089-145884111 CAGCAGGACAGGAAGCAAAGTGG + Intergenic
999452468 5:151688643-151688665 TTGAAGGACTGGAAGGAAGTTGG - Intergenic
999818931 5:155205014-155205036 CAGAAGGACTAGAAAAAAGTGGG + Intergenic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1001352870 5:170987863-170987885 GAGAAATACAGGAAGTAAATTGG + Intronic
1001723990 5:173881221-173881243 TAGAAGGACTGAAAGAGAATGGG - Intergenic
1001858977 5:175036706-175036728 CAGAGGGGCAGGAAGAAAATTGG + Intergenic
1001864236 5:175089350-175089372 CAGAAGAAGTGGAATTAATTGGG + Intergenic
1001929172 5:175660494-175660516 AAAAAAGACTGGAAGGAAATAGG + Intronic
1002110624 5:176908221-176908243 AAAAAAGACTGGAAGAAAATAGG + Intronic
1002132213 5:177088472-177088494 CAGATGGACTGGAAGTGGAGTGG + Intronic
1003601102 6:7518195-7518217 CTGAAAGACTGGAAGGAATTGGG - Intergenic
1005024707 6:21451435-21451457 GAGAAGGACTGGTGGTAAAGAGG - Intergenic
1005403704 6:25462700-25462722 CAGCAGGACAGCAAGTAATTCGG - Intronic
1006238958 6:32660987-32661009 CTGAAGGCCTGGAAGAACATGGG - Intronic
1006864309 6:37196457-37196479 AAGAAGCACTGGATTTAAATTGG + Intergenic
1008071458 6:47103029-47103051 CAGGAGGAAAGGAAGCAAATGGG + Intergenic
1009499891 6:64398253-64398275 CAGAAGGAGAGGGATTAAATAGG + Intronic
1009566710 6:65319869-65319891 CAGCAGGCCAGGAAGTCAATAGG - Intronic
1009931584 6:70182600-70182622 CAGAGAGACAGGAAGAAAATCGG + Intronic
1010026187 6:71219934-71219956 CACAAGGACTGGAAGAGAACTGG + Intergenic
1010679358 6:78781405-78781427 GAGAGGGACTGGAAGTGGATGGG - Intergenic
1011286643 6:85731831-85731853 AAGAAGGACTTGAAGTTCATAGG + Intergenic
1014026374 6:116651270-116651292 CAGAAGGATTGAAGGTAAACAGG + Intronic
1014899718 6:126947874-126947896 CACAAGGAATGGAAATATATAGG - Intergenic
1015236608 6:130978404-130978426 ATGAAGGACTGGAAGTACACTGG - Intronic
1016798876 6:148147760-148147782 CAGTTGGACTGTAAGTATATGGG + Intergenic
1017450220 6:154548143-154548165 CATATGGATTGGAAGTAAATTGG + Intergenic
1019157313 6:170047962-170047984 CAGAAGGACTGGAGGTTGAAGGG + Intergenic
1021109264 7:16675581-16675603 CAGAAGGCCTAGTAGTCAATGGG - Intronic
1022224011 7:28344788-28344810 CAAATGGACTGAAAGTAAAAAGG + Intronic
1022420208 7:30213119-30213141 CAGAATGGTAGGAAGTAAATGGG - Intergenic
1022935333 7:35169569-35169591 CAGAAAGGCTGGAAGGAAAGGGG - Intergenic
1025821065 7:64964444-64964466 CATGAGCACTGGAATTAAATAGG - Intergenic
1026381180 7:69800851-69800873 TAGAAGGAATGTAAATAAATGGG - Intronic
1027286957 7:76655902-76655924 TAGAAAGACTGAAAGTCAATAGG + Intergenic
1028403011 7:90445163-90445185 CCACAGGACTGGAAGTGAATGGG + Intronic
1029831287 7:103262345-103262367 CAGAAAGGCTGGAAGGAAAGGGG - Intergenic
1029944297 7:104515610-104515632 TAGAATGACTGGAATTAAAAAGG + Intronic
1029962307 7:104700895-104700917 CAGCAGGCCTGGAGATAAATTGG - Intronic
1030471162 7:109963928-109963950 TTGCAGGACTGGAAGTAACTGGG + Intergenic
1031507939 7:122609709-122609731 CAGAACTACAGGAAGGAAATAGG + Intronic
1033113953 7:138608725-138608747 TAGAAGGCCTGGAAGAAAAGAGG + Intronic
1033763259 7:144460220-144460242 CACAACGACTGGAACTAATTTGG + Intronic
1035313947 7:157986765-157986787 TGGCAGGACTGGAAGTAACTGGG + Intronic
1036596942 8:10221862-10221884 CAGAAGGAATGCAAGTACAAAGG + Intronic
1037294679 8:17387563-17387585 CAGAAGGATTGTTAGTATATCGG + Intronic
1039194100 8:35011058-35011080 CATAAGGACTCGAAGTATGTAGG - Intergenic
1039961716 8:42253492-42253514 CAGAAGGGTTGGAAAAAAATTGG + Intergenic
1040936526 8:52787658-52787680 GGGAAGGAGGGGAAGTAAATGGG + Intergenic
1045128177 8:99117790-99117812 GAGAATGACTGCAAATAAATAGG + Intronic
1045189097 8:99865767-99865789 CAGAAGGACAGGCATAAAATGGG - Intronic
1045706713 8:104931818-104931840 GAGAAGGACTAGAAATAAAGCGG + Intronic
1046004821 8:108466221-108466243 AAGAAGCAATGGTAGTAAATGGG + Intronic
1047803402 8:128333199-128333221 AAAAAAGACTGGTAGTAAATGGG - Intergenic
1048240415 8:132736118-132736140 CAGAAGGATTGTAAGGGAATTGG + Intronic
1048503915 8:135003752-135003774 AAGAAAGACTGGAGGTAAAAGGG + Intergenic
1049050321 8:140189583-140189605 GAGAAAAACTGGAAGGAAATAGG + Intronic
1049820678 8:144631321-144631343 CAGAAGGACAGGCAAGAAATGGG - Intergenic
1051411978 9:16799239-16799261 AAAAATGACTGGAAGGAAATAGG - Intronic
1055869767 9:80861255-80861277 TAGAAGCACTGCAAGTATATAGG + Intergenic
1056084639 9:83134148-83134170 CAGAAAGTCTGGATGTAAGTGGG - Intergenic
1056281157 9:85042315-85042337 CAGAAGGACTAGAAGGGAAAAGG - Intergenic
1057999380 9:99849519-99849541 CATCAGGACTGGAAGGAAACTGG + Intronic
1058179686 9:101781509-101781531 CAGAAGTACAGGAAGAAAGTAGG - Intergenic
1058577964 9:106423688-106423710 GAGAGGGGCTGGAAGAAAATAGG - Intergenic
1061050227 9:128191033-128191055 TAGCAGGACTGGAGGTAACTTGG - Intronic
1062306357 9:135908909-135908931 TGGAAGGACTGGTAGGAAATGGG + Intergenic
1185802875 X:3029359-3029381 CAGAAGGACTGTAAGTATGAAGG + Exonic
1186756579 X:12678037-12678059 AAAAAAGACTGGAAGGAAATAGG - Intronic
1187108354 X:16268975-16268997 CAGTAGACCTGGAACTAAATGGG - Intergenic
1190257108 X:48771851-48771873 AAGAAGGACTGAAAGAAGATTGG + Intronic
1193894057 X:87088810-87088832 CAATAAGACTGAAAGTAAATGGG + Intergenic
1194779329 X:98004642-98004664 CAAAAGGAGATGAAGTAAATGGG + Intergenic
1196062346 X:111424020-111424042 CTGAAGGACAGGAAGTAGATAGG + Intergenic
1196085362 X:111678317-111678339 GAAAAGGATTGGAGGTAAATTGG - Intronic
1196564274 X:117186704-117186726 CAGAAGGTATGAAAGAAAATGGG - Intergenic
1199107812 X:143891865-143891887 CAGAAGCACTGGATTCAAATTGG + Intergenic