ID: 903366159

View in Genome Browser
Species Human (GRCh38)
Location 1:22806643-22806665
Sequence CACAGCTAACACCTGCCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 187}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903366159_903366163 -6 Left 903366159 1:22806643-22806665 CCGCCAGGCAGGTGTTAGCTGTG 0: 1
1: 0
2: 2
3: 18
4: 187
Right 903366163 1:22806660-22806682 GCTGTGCCCTCCACAGGGCCAGG 0: 1
1: 0
2: 6
3: 64
4: 521
903366159_903366172 17 Left 903366159 1:22806643-22806665 CCGCCAGGCAGGTGTTAGCTGTG 0: 1
1: 0
2: 2
3: 18
4: 187
Right 903366172 1:22806683-22806705 CCCCACAGGGACAAAGCCGAGGG 0: 1
1: 0
2: 0
3: 8
4: 122
903366159_903366168 4 Left 903366159 1:22806643-22806665 CCGCCAGGCAGGTGTTAGCTGTG 0: 1
1: 0
2: 2
3: 18
4: 187
Right 903366168 1:22806670-22806692 CCACAGGGCCAGGCCCCACAGGG 0: 1
1: 0
2: 8
3: 93
4: 544
903366159_903366177 30 Left 903366159 1:22806643-22806665 CCGCCAGGCAGGTGTTAGCTGTG 0: 1
1: 0
2: 2
3: 18
4: 187
Right 903366177 1:22806696-22806718 AAGCCGAGGGCGCGCCTGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 108
903366159_903366175 26 Left 903366159 1:22806643-22806665 CCGCCAGGCAGGTGTTAGCTGTG 0: 1
1: 0
2: 2
3: 18
4: 187
Right 903366175 1:22806692-22806714 GACAAAGCCGAGGGCGCGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 75
903366159_903366170 16 Left 903366159 1:22806643-22806665 CCGCCAGGCAGGTGTTAGCTGTG 0: 1
1: 0
2: 2
3: 18
4: 187
Right 903366170 1:22806682-22806704 GCCCCACAGGGACAAAGCCGAGG 0: 1
1: 0
2: 2
3: 13
4: 195
903366159_903366166 3 Left 903366159 1:22806643-22806665 CCGCCAGGCAGGTGTTAGCTGTG 0: 1
1: 0
2: 2
3: 18
4: 187
Right 903366166 1:22806669-22806691 TCCACAGGGCCAGGCCCCACAGG 0: 1
1: 0
2: 3
3: 42
4: 316
903366159_903366176 27 Left 903366159 1:22806643-22806665 CCGCCAGGCAGGTGTTAGCTGTG 0: 1
1: 0
2: 2
3: 18
4: 187
Right 903366176 1:22806693-22806715 ACAAAGCCGAGGGCGCGCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903366159 Original CRISPR CACAGCTAACACCTGCCTGG CGG (reversed) Intronic
900364559 1:2305799-2305821 CACAGCTGCCACAGGCCTGGCGG + Intronic
900495667 1:2974928-2974950 CACAGGGAACCCCTCCCTGGCGG + Intergenic
903366159 1:22806643-22806665 CACAGCTAACACCTGCCTGGCGG - Intronic
903569218 1:24291977-24291999 CGCACTTCACACCTGCCTGGGGG + Intergenic
904011103 1:27391209-27391231 CAAACCCAAAACCTGCCTGGTGG + Intergenic
905273409 1:36801730-36801752 CAGAGCTGCCACCTGCCTGTTGG - Exonic
905860489 1:41347588-41347610 AACTGCTATCACCTGCCTGAGGG - Intergenic
907968708 1:59359599-59359621 CACAGCTAAGACCTCCCTGGAGG + Intronic
910436107 1:87207782-87207804 CACAGCCAACACCTGGCTCTTGG + Intergenic
911429432 1:97765520-97765542 AACAGCTCACACCTCCCAGGTGG + Intronic
915082912 1:153364368-153364390 CACTGCTAACACCAGCCTGGAGG - Intergenic
915553501 1:156648323-156648345 CTCATCTACCACCTGCCAGGTGG + Intronic
916107548 1:161442303-161442325 TCCCGCTAACACCTGCCTGCCGG + Intergenic
916109132 1:161449721-161449743 TCCCGCTAACACCTGCCTGCCGG + Intergenic
916110720 1:161457102-161457124 TCCCGCTAACACCTGCCTGCCGG + Intergenic
916112305 1:161464512-161464534 TCCCGCTAACACCTGCCTGCCGG + Intergenic
916113892 1:161471893-161471915 TCCCGCTAACACCTGCCTGCCGG + Intergenic
916679401 1:167090332-167090354 GACAGCTCAGACCTGTCTGGAGG - Exonic
919182362 1:194103212-194103234 CACAGAAAACACCTGCCTTCTGG + Intergenic
919182380 1:194103368-194103390 CACAGCTGACACCCACCTGCAGG - Intergenic
920377497 1:205517024-205517046 CAGACCTAATACCTGCCTTGGGG - Intronic
922724221 1:227914998-227915020 CAGAGCTGTCACCTCCCTGGAGG - Intergenic
1062905787 10:1178653-1178675 CCCTGCTAAGAGCTGCCTGGGGG + Exonic
1064771483 10:18728216-18728238 CAAAGCTACAACCTGACTGGTGG - Intergenic
1067027834 10:42859255-42859277 CCCAGTTGACACCTTCCTGGTGG - Intergenic
1067662876 10:48249688-48249710 CACAGGTCACACGTGCTTGGGGG - Intronic
1067676862 10:48388475-48388497 CACAGCAACCACCAGCCTAGAGG - Intronic
1068314220 10:55320383-55320405 CACTGCAAACACCTGCATAGAGG + Intronic
1069653253 10:70067032-70067054 CACTGTTAACACGTGCCTGAAGG - Intronic
1069774646 10:70919338-70919360 CACAGCTAACACAGACCTGCGGG - Intergenic
1070529447 10:77323906-77323928 CATAGGTAAATCCTGCCTGGAGG + Intronic
1070707793 10:78653979-78654001 CACAGCTTTCACTTGTCTGGAGG + Intergenic
1072713800 10:97736166-97736188 CACAGCTAAGTCCTGGCTGGAGG + Intergenic
1072903652 10:99431041-99431063 CACCGCCAACACCTGCTCGGCGG - Intergenic
1073178851 10:101571889-101571911 TACAGCTAACTCCTCACTGGAGG + Intronic
1075651379 10:124129994-124130016 CACTTCTGACACCCGCCTGGAGG + Intergenic
1075738230 10:124677365-124677387 CACAGAGAACACCAGCCAGGAGG + Intronic
1075742032 10:124701791-124701813 CACAGGGCCCACCTGCCTGGGGG - Intronic
1075990162 10:126830307-126830329 CACAGCTAACATCTTACTGATGG + Intergenic
1076685413 10:132196420-132196442 CACATCCAGCACCTGCCTGCAGG - Intronic
1077461337 11:2712283-2712305 CACTGGTGACCCCTGCCTGGGGG + Intronic
1079108237 11:17587957-17587979 CTCAGCTATCCCCTGCCTGAGGG - Intronic
1079347646 11:19667093-19667115 CACAGCTAGCAGCTTCCTGGGGG - Intronic
1079382422 11:19949578-19949600 CTCAGCTGACACCTCCTTGGAGG + Intronic
1080831107 11:35894107-35894129 TGCAGGTAACAGCTGCCTGGAGG - Intergenic
1083967733 11:66052713-66052735 CGCCGCCAACACCTACCTGGCGG - Exonic
1087217720 11:95512251-95512273 CAGAGGTAACTCCAGCCTGGAGG + Intergenic
1088640803 11:111871275-111871297 CACAGCTAAGACCCTCCCGGGGG + Intronic
1089381473 11:118035772-118035794 CACACTTAGCACCTGCCTGGAGG - Intergenic
1089704631 11:120269009-120269031 CCCAGCTATCACCACCCTGGAGG + Intronic
1090355870 11:126140002-126140024 AACAGCTACAACCTCCCTGGGGG - Intergenic
1091066951 11:132523373-132523395 CACTGATGACACCTGTCTGGGGG - Intronic
1091546797 12:1506587-1506609 CTCATCTAACCCCTGCCTGCAGG + Intergenic
1091566093 12:1649234-1649256 GAGAGCTAAGACCTGCCGGGAGG + Intergenic
1093831464 12:23765331-23765353 CATAGCTAACACATGACTGCAGG - Intronic
1098345203 12:69495367-69495389 CTCAGCTTACTCATGCCTGGTGG + Intronic
1101815957 12:108146412-108146434 CACAGAGGCCACCTGCCTGGAGG + Intronic
1102199632 12:111048433-111048455 CACAGCTCCCACCTTGCTGGGGG - Intronic
1106052347 13:26203565-26203587 CACTGCTAGGAGCTGCCTGGGGG - Intronic
1107975455 13:45683938-45683960 CCCAGGCAACTCCTGCCTGGGGG + Intergenic
1110168664 13:72474070-72474092 CACAGCTAATGCCTTCCTGGGGG + Intergenic
1113239095 13:108316406-108316428 CCCAGCTAACACCTCCAGGGTGG - Intergenic
1113634896 13:111912746-111912768 CGCAGCTGTCACTTGCCTGGTGG + Intergenic
1113928624 13:113954621-113954643 CACCTCTCACTCCTGCCTGGTGG + Intergenic
1121441718 14:93953861-93953883 CAGAGGTGACACCTGCCTGCAGG + Intronic
1121639650 14:95476494-95476516 CCTAGGTAACACCTGCCTGCTGG + Intergenic
1122204248 14:100140718-100140740 CAGAGTTCACACCGGCCTGGAGG - Intronic
1122965292 14:105121096-105121118 CCCAGCAAACAACTGCCTTGGGG + Intergenic
1123019385 14:105390531-105390553 CACAGCAGACACCTGGCGGGAGG - Intronic
1125486222 15:40112661-40112683 CCCATCTAACCCCTCCCTGGGGG - Intergenic
1127597734 15:60503695-60503717 AAAAGCTAACATCTTCCTGGAGG - Intronic
1127988309 15:64092647-64092669 CACAATTATCATCTGCCTGGAGG + Intronic
1130229284 15:82084369-82084391 CACAGCTCACACTTGCGAGGTGG - Intergenic
1130440299 15:83946166-83946188 CACAGTTATATCCTGCCTGGTGG + Intronic
1131075061 15:89490282-89490304 CTCAGCTAGCAGCTACCTGGAGG + Intronic
1132354719 15:101162875-101162897 CTCAGCCAACACCTGCCAGGAGG + Intergenic
1132506469 16:312035-312057 CTCACCTAACACTTGCCTCGGGG + Intronic
1134220058 16:12346730-12346752 AGCAGCCAACACCTTCCTGGTGG - Intronic
1134599399 16:15521583-15521605 CAGAGTTCACACCTGCCTGCTGG - Intronic
1136856810 16:33665724-33665746 CCCAGTTGACACCTTCCTGGTGG + Intergenic
1142015906 16:87747191-87747213 CGGAGCCAACACCAGCCTGGCGG + Intronic
1142187793 16:88702643-88702665 CAGAGCCACCACCTGGCTGGTGG + Intronic
1203140172 16_KI270728v1_random:1759498-1759520 AACATCTAACACCTGTTTGGTGG + Intergenic
1143308799 17:5971292-5971314 CACAGCTCACAACTGAGTGGGGG + Intronic
1143583343 17:7838890-7838912 CACAAATAGCACCTCCCTGGGGG + Intergenic
1144670289 17:17128998-17129020 CCCAGCTCCCAGCTGCCTGGTGG - Intronic
1146056726 17:29585080-29585102 GACCGCCAACACCTTCCTGGGGG + Intronic
1146790621 17:35748619-35748641 CACCCCTACCACTTGCCTGGGGG - Intronic
1148901981 17:50885121-50885143 CACAGCTGACAAGTGTCTGGGGG + Intergenic
1151902365 17:77024954-77024976 CATAGCTAGGAGCTGCCTGGTGG - Intergenic
1152408047 17:80108553-80108575 CACCGCTATCACCCGCCAGGTGG + Intergenic
1152924718 17:83081535-83081557 CGCTGCTGTCACCTGCCTGGAGG - Intronic
1154018089 18:10637964-10637986 CACAGCCACCACCTGCATCGAGG - Intergenic
1154186780 18:12191618-12191640 CACAGCCACCACCTGCATCGAGG + Intergenic
1156464916 18:37342652-37342674 CACAGCTAAGAGATGCCTGCAGG - Intronic
1157433625 18:47651083-47651105 CACACCTCCCACCTGCCTGTGGG - Intergenic
1157502447 18:48201000-48201022 AACATCTAACACCTGCATGTGGG + Intronic
1159303329 18:66606477-66606499 CACAGTTATCACCTGCCAGCAGG + Intergenic
1160435122 18:78845685-78845707 CACAGCTTACAGCAGCCAGGTGG - Intergenic
1160775503 19:853318-853340 CACGGCGAACACCTGCCGGGTGG - Exonic
1160822304 19:1064268-1064290 CTCACCCCACACCTGCCTGGAGG - Intronic
1161348011 19:3777626-3777648 CCCAGCTGGCACCTGCCTGCTGG - Intergenic
1161496250 19:4587502-4587524 CCCAGCTCACTCCTGCCTCGGGG + Intergenic
1161777400 19:6271039-6271061 CCCAGCTCACTCCTGCCTCGGGG + Intronic
1162836156 19:13319545-13319567 CACAGCAAACACCTCCAAGGAGG + Intronic
1163786138 19:19275847-19275869 CACAGCCAACACCTGTGTGCTGG + Intergenic
1165244889 19:34493188-34493210 CCCAGCTAGCACCTGCCTCCTGG - Intronic
1168626885 19:57925691-57925713 CACAGTGAACACCTGCCTCGTGG + Exonic
925387345 2:3471422-3471444 CACGGCTGTCACCTGTCTGGCGG - Intronic
926140601 2:10365658-10365680 AACAGCTAACAGGTGCTTGGTGG + Intronic
927526446 2:23745570-23745592 CACAGCTAACATCAGGTTGGGGG - Intergenic
929603628 2:43220200-43220222 CGGTGCTAAAACCTGCCTGGGGG - Intergenic
929773688 2:44914390-44914412 CCCAGCTCACACCTGACTGTGGG - Intergenic
935140774 2:100350990-100351012 CACAGTTACCACCTACATGGAGG + Intergenic
937303099 2:120855267-120855289 CACAGCTGACAGCTGCCTCCAGG - Intronic
937663903 2:124462886-124462908 CACTGCAAACAGCTGCCTGTTGG + Intronic
937706326 2:124924849-124924871 CACATCTTTCACCTGCGTGGAGG + Intergenic
945889084 2:215409469-215409491 CACAGATACCACCTGCCTAGAGG + Intronic
947129776 2:226909460-226909482 CATGGCTAACACCTGGCTGCTGG - Intronic
947344660 2:229178344-229178366 AACTGCTAACGCCTGCCAGGAGG - Intronic
948778098 2:240300399-240300421 CTCAGCCAACACCTGCCTCCTGG - Intergenic
1171181579 20:23094772-23094794 CACAGCCAGCACCTACCTGGGGG - Intergenic
1172484286 20:35288947-35288969 CACAGCCACCACCTGGGTGGGGG + Exonic
1179306288 21:40156249-40156271 CACAGCTTCCACCTGCCTCCTGG - Intronic
1179556318 21:42179516-42179538 CTCAGCCAACAGCTGCATGGGGG - Intergenic
1181748548 22:24973044-24973066 CCCAGCTTGCTCCTGCCTGGGGG - Intronic
1183176648 22:36229289-36229311 CACAGCCAACACCAGGGTGGGGG - Intronic
1183181583 22:36263804-36263826 CACAGCCAACACCAGGGTGGGGG + Intronic
1183902660 22:41018240-41018262 CACAGCTTCCACCTGCCCGCTGG + Intergenic
1184770498 22:46594283-46594305 CACAGGCCATACCTGCCTGGTGG + Intronic
1185415103 22:50705406-50705428 CACCGCCAGCAGCTGCCTGGAGG + Intergenic
1203224379 22_KI270731v1_random:69103-69125 CACAGCTCAGACCTTTCTGGGGG - Intergenic
951660070 3:25053566-25053588 CACAGCTTACAGATGCCTAGAGG - Intergenic
957286285 3:78221557-78221579 CACAGCTAGGATCTTCCTGGGGG + Intergenic
960571402 3:119188565-119188587 TTCAGCTCACACCTGCCTGTGGG + Intronic
961211693 3:125130730-125130752 TGCTGCTAACTCCTGCCTGGAGG + Intronic
961454711 3:127018193-127018215 CACCCCCAACACCTGCCTGTGGG - Intronic
962873372 3:139517511-139517533 CTCTGCTAACAGATGCCTGGGGG + Exonic
963010869 3:140769058-140769080 CACAGCTGTCAGCTGCCTGTGGG - Intergenic
968389275 4:175754-175776 CACAGTTAACTCTTCCCTGGAGG - Intergenic
972411242 4:38797047-38797069 CACAGCCAACACCAGCATGGTGG + Exonic
972414773 4:38827674-38827696 CACAGCCAACACCAGCATGGTGG + Exonic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
974911935 4:68133084-68133106 CATAGCTGACACCTACCTGCAGG + Intergenic
981297830 4:143153592-143153614 CACAGCCAAACCATGCCTGGAGG - Intergenic
982198840 4:152939932-152939954 CACAGCTGACAACTGCCAGTAGG - Intronic
984027203 4:174557366-174557388 CACAACAAAAACCTGCTTGGGGG - Intergenic
988131225 5:27108758-27108780 GACAGTTAACAACTGCCTGGTGG + Intronic
988902070 5:35744711-35744733 CACAGCACACTCCAGCCTGGGGG + Intronic
992462189 5:76971655-76971677 CACAGCTCACCCCTGTCTGCAGG + Intronic
995955686 5:117773544-117773566 AACCACCAACACCTGCCTGGTGG - Intergenic
996871898 5:128201461-128201483 CCCAGCGCACACCTGCCCGGCGG - Intergenic
996939939 5:128992387-128992409 CACAGCTGACACTAGGCTGGAGG + Intronic
997433238 5:133856114-133856136 CACATCTAACACGTTCCAGGTGG + Intergenic
998502414 5:142645072-142645094 TAAAGCTAAGAGCTGCCTGGGGG - Intronic
999754381 5:154653549-154653571 CACAGATAACATGTTCCTGGGGG - Intergenic
1002537281 5:179883698-179883720 CACAGTTTTCATCTGCCTGGAGG + Intronic
1004982558 6:21042418-21042440 CACAACTAACACCTCTCTCGTGG + Intronic
1006639752 6:35483808-35483830 CACAGCTCTTTCCTGCCTGGGGG + Intronic
1007622278 6:43222520-43222542 CACAGCAAACTCCTGTGTGGAGG - Exonic
1007668175 6:43528963-43528985 CACATCTCTCACCTGCCAGGTGG + Intronic
1014575009 6:123058943-123058965 TAAAGCTAAGGCCTGCCTGGTGG - Intronic
1014936358 6:127389537-127389559 CACAGCTAACATGTGCCTAAAGG - Intergenic
1016923638 6:149318383-149318405 CCCACCTCACACATGCCTGGGGG - Intronic
1018206517 6:161441798-161441820 TGCAGCTGCCACCTGCCTGGGGG + Intronic
1018812308 6:167306978-167307000 CACAGATGCTACCTGCCTGGGGG + Intronic
1024030755 7:45457736-45457758 CTCAGCTACCACCTGCCAGCTGG + Intergenic
1024095598 7:45980154-45980176 CACAGCCAACACCTGGCAGTGGG + Intergenic
1030123820 7:106135821-106135843 AACAGCTTACACCTGCAAGGAGG - Intergenic
1031280896 7:119797883-119797905 CCCAGCTAACACCTGCCCACTGG - Intergenic
1032081040 7:128858633-128858655 CACTACAAACACCTGCCTTGGGG + Exonic
1032091209 7:128912524-128912546 CACTACAAACACCTGCCTTGGGG - Intergenic
1033134961 7:138776597-138776619 CAAAGCAAACACCTGCCTTGGGG - Intronic
1034445414 7:151111527-151111549 CACACCTCACACCTGCCCAGGGG + Intronic
1035219969 7:157400664-157400686 CACAGCTGACACGTGCCAGGCGG - Intronic
1035360610 7:158310972-158310994 CACACCACACATCTGCCTGGAGG + Intronic
1035694699 8:1586338-1586360 CAGAGCTAACACATCCCTGTGGG - Intronic
1036000657 8:4599969-4599991 CACAGTGAACACCTCCATGGAGG - Intronic
1036405858 8:8454765-8454787 CAGAGCTAAGAATTGCCTGGAGG + Intergenic
1036659557 8:10699234-10699256 CACTGCTGGCCCCTGCCTGGTGG + Intronic
1038083937 8:24173134-24173156 AACATCTAGCACCTTCCTGGTGG - Intergenic
1040600456 8:48878728-48878750 CACAGATAACACCGTCCTGCAGG + Intergenic
1041524550 8:58790619-58790641 CAGAGCCAACACCTGCTTGGTGG - Intergenic
1042213189 8:66402272-66402294 CACAGCTAACAAGAGCATGGGGG - Intergenic
1042350814 8:67775535-67775557 CACAGCACACACCTGCCAGAGGG + Intergenic
1043355170 8:79403235-79403257 CATGGCTGACACCTGTCTGGTGG - Intergenic
1043962295 8:86430739-86430761 AACAGCTTACCCCAGCCTGGTGG - Exonic
1044861385 8:96526925-96526947 CAGAGCTACCACCTCCCTAGAGG - Intronic
1048930944 8:139315094-139315116 CACAGCTAACAGAAGCATGGTGG + Intergenic
1049411397 8:142475467-142475489 CACAGCTTCCAGCCGCCTGGGGG - Exonic
1052496539 9:29232999-29233021 TCCAGCAAACACCTGACTGGGGG + Intergenic
1053005332 9:34600477-34600499 CATAGCTAGTGCCTGCCTGGAGG + Intergenic
1056694430 9:88834099-88834121 TTCAGCCAAGACCTGCCTGGAGG - Intergenic
1061015152 9:127977142-127977164 AACAGCAAACAGGTGCCTGGTGG + Intronic
1061411820 9:130425959-130425981 CCCAGCTAAAACCTGCCAGGGGG + Intronic
1061667342 9:132168318-132168340 CAGAGGTACCAGCTGCCTGGGGG - Intronic
1062123524 9:134847207-134847229 CACACCTTACCCCTGCCTTGTGG - Intergenic
1185933107 X:4224932-4224954 CACAGCTAACATCTGTCTAGAGG - Intergenic
1188987583 X:36781273-36781295 CACAGGGTACACCTGGCTGGTGG - Intergenic
1189179205 X:38987447-38987469 CACAGCTCACAACTGCCAGCAGG - Intergenic
1189281097 X:39820705-39820727 CACAGGTACCACCTGGGTGGTGG - Intergenic
1194608393 X:96009750-96009772 CACAGGAAAGACCTGCCTGCAGG - Intergenic
1196031936 X:111101306-111101328 CACTCCTCTCACCTGCCTGGGGG - Intronic
1197242492 X:124134916-124134938 CACAGTTCACATCTGCATGGAGG - Intronic
1198144947 X:133845869-133845891 CAAATCTAACACCTGGATGGAGG - Intronic
1198299156 X:135317632-135317654 CACAGGTGACACCTACCTGTGGG - Intronic
1201235543 Y:11907535-11907557 CACAGCTAACACCTTACTTTGGG + Intergenic
1201714054 Y:17023983-17024005 CACAGCTAACATCTGTCTAGGGG - Intergenic