ID: 903368523

View in Genome Browser
Species Human (GRCh38)
Location 1:22819482-22819504
Sequence GTGACTTAATGGCCCTACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 65}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903368523_903368528 10 Left 903368523 1:22819482-22819504 CCCCAGTAGGGCCATTAAGTCAC 0: 1
1: 0
2: 1
3: 3
4: 65
Right 903368528 1:22819515-22819537 ACCAAGTTATAAATAAGTAAAGG 0: 1
1: 0
2: 2
3: 34
4: 333
903368523_903368531 12 Left 903368523 1:22819482-22819504 CCCCAGTAGGGCCATTAAGTCAC 0: 1
1: 0
2: 1
3: 3
4: 65
Right 903368531 1:22819517-22819539 CAAGTTATAAATAAGTAAAGGGG 0: 1
1: 0
2: 5
3: 53
4: 556
903368523_903368534 27 Left 903368523 1:22819482-22819504 CCCCAGTAGGGCCATTAAGTCAC 0: 1
1: 0
2: 1
3: 3
4: 65
Right 903368534 1:22819532-22819554 TAAAGGGGTGAGGGTCCCCAAGG 0: 1
1: 0
2: 0
3: 8
4: 143
903368523_903368530 11 Left 903368523 1:22819482-22819504 CCCCAGTAGGGCCATTAAGTCAC 0: 1
1: 0
2: 1
3: 3
4: 65
Right 903368530 1:22819516-22819538 CCAAGTTATAAATAAGTAAAGGG 0: 1
1: 0
2: 1
3: 59
4: 550
903368523_903368533 18 Left 903368523 1:22819482-22819504 CCCCAGTAGGGCCATTAAGTCAC 0: 1
1: 0
2: 1
3: 3
4: 65
Right 903368533 1:22819523-22819545 ATAAATAAGTAAAGGGGTGAGGG 0: 1
1: 1
2: 2
3: 66
4: 523
903368523_903368532 17 Left 903368523 1:22819482-22819504 CCCCAGTAGGGCCATTAAGTCAC 0: 1
1: 0
2: 1
3: 3
4: 65
Right 903368532 1:22819522-22819544 TATAAATAAGTAAAGGGGTGAGG 0: 1
1: 0
2: 3
3: 41
4: 464
903368523_903368535 28 Left 903368523 1:22819482-22819504 CCCCAGTAGGGCCATTAAGTCAC 0: 1
1: 0
2: 1
3: 3
4: 65
Right 903368535 1:22819533-22819555 AAAGGGGTGAGGGTCCCCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903368523 Original CRISPR GTGACTTAATGGCCCTACTG GGG (reversed) Intronic
902902249 1:19526014-19526036 ATGACTCAGTGGCTCTACTGAGG - Intergenic
903368523 1:22819482-22819504 GTGACTTAATGGCCCTACTGGGG - Intronic
905257429 1:36694076-36694098 GTGGCTTAATAGCCCCACTATGG + Intergenic
909290849 1:73881433-73881455 GTTACTTCATGGCTCTGCTGTGG - Intergenic
911581982 1:99644667-99644689 GAAACTTATTGGCCCTACTGAGG - Intergenic
911585895 1:99690024-99690046 GTGACTTAATCACTTTACTGTGG - Intronic
912749092 1:112270622-112270644 GTGACTTACTGGTTTTACTGGGG - Intergenic
917930131 1:179817264-179817286 GTGGCTGAAGGGCCCTGCTGAGG + Intergenic
920884205 1:209910779-209910801 GTGACTTCTAGGCCCTGCTGTGG - Intergenic
1065710207 10:28508675-28508697 TTCACTAAATGGCCCCACTGTGG - Intergenic
1068065022 10:52120151-52120173 ATGAATTAATGTCCTTACTGAGG - Intronic
1077578664 11:3403104-3403126 GTCACTGAATGACCCAACTGGGG - Intergenic
1082223505 11:49671857-49671879 GTGACTTTATTGTCCTAGTGAGG + Intergenic
1084235697 11:67786618-67786640 GTCACTCAATGACCCAACTGGGG - Intergenic
1085128543 11:74018462-74018484 GTCACTTAAAGGGGCTACTGTGG - Intronic
1086625554 11:88947405-88947427 GTGACTTTATTGTCCTAGTGAGG - Intronic
1091989380 12:4942475-4942497 GTGACTTACTGACTCTGCTGAGG - Intergenic
1095605643 12:44064018-44064040 GTGAATTTATGGGCCTCCTGGGG + Intronic
1096969900 12:55657363-55657385 CTGACTTCATGGCTCTGCTGTGG - Intergenic
1103892370 12:124249625-124249647 GTTACTTAATGGCCCAGCTTAGG + Intronic
1105776556 13:23667482-23667504 GAGACTTCTTGGCCCCACTGAGG - Intronic
1110379435 13:74833762-74833784 TTGACCTAAATGCCCTACTGAGG - Intergenic
1119944354 14:78676118-78676140 GCCAATTAATAGCCCTACTGTGG + Intronic
1121570772 14:94945093-94945115 CTGTCTTGATGGCCCTCCTGGGG + Intergenic
1125189509 15:36974333-36974355 TGGACTTAATGGTCTTACTGGGG - Intronic
1133347271 16:5079254-5079276 GTCACTCAATGACCCAACTGGGG - Intronic
1137809706 16:51341112-51341134 TTTACTTCATGGCACTACTGTGG - Intergenic
1139463893 16:67143520-67143542 GTGACTTACTGCACCTCCTGGGG + Intronic
1143317959 17:6046968-6046990 ATGACTTAATGTCCCTACATAGG + Intronic
1160911251 19:1474801-1474823 GTGACCTGAGGGCCCCACTGGGG - Exonic
928632759 2:33210827-33210849 GTGACTCAATGGCTCTACTGGGG - Intronic
947526145 2:230877910-230877932 GTCACTTCCTGGCCCTCCTGTGG + Intronic
1170455761 20:16531418-16531440 GTGAATTAATGGCTCTAGGGAGG + Intronic
1171232832 20:23500967-23500989 GTTACTTAACAGGCCTACTGCGG + Intergenic
1177321399 21:19525467-19525489 GTGACTTAAAAGGGCTACTGTGG - Intergenic
1178427718 21:32492209-32492231 GTGCCTAAATGCCCCTATTGAGG - Intronic
1179574351 21:42298433-42298455 GTGGCTTCATGGCCCTAATAGGG + Intergenic
1179938458 21:44621524-44621546 GGGACATGATGGCCCTACTGGGG - Intronic
1180631602 22:17233885-17233907 GTGACTTAATGGGCCTGGGGCGG - Intergenic
950701891 3:14756628-14756650 GTGACATAATGGCTCTATGGAGG + Intronic
951575737 3:24111903-24111925 GAGACTTAGTGGCTCTACTCTGG + Intergenic
952404318 3:32992093-32992115 TGGACTTAAAGGCCCTAGTGTGG - Intergenic
955730789 3:61984104-61984126 GTGATTTATTCTCCCTACTGTGG + Intronic
960308135 3:116087628-116087650 GTGTCTTAATAGTCCTGCTGTGG - Intronic
961302806 3:125933177-125933199 GTCACTCAATGACCCAACTGAGG + Intronic
961885257 3:130092595-130092617 GTCACTCAATGACCCAACTGGGG - Intronic
968994449 4:3936797-3936819 GTCACTCAATGACCCAACTGGGG - Intergenic
969819488 4:9709439-9709461 GTCACTCAATGACCCAACTGGGG + Intergenic
983546362 4:168968727-168968749 GTGACTTAATGGCTGAAGTGTGG - Intronic
992833333 5:80616745-80616767 GTGACTTAATGGCACCAGAGAGG + Intergenic
993087126 5:83376989-83377011 CTGGCTAAATGGCCCTCCTGAGG + Intergenic
997566639 5:134892757-134892779 GTGAATTAATAACCCTACAGTGG - Intronic
999278905 5:150351581-150351603 GTCTGTTGATGGCCCTACTGAGG + Intergenic
1003958445 6:11187866-11187888 GTTACTGAATTCCCCTACTGTGG + Intronic
1004457579 6:15805193-15805215 GTGACTTAATGCCTCTATTTAGG + Intergenic
1010776107 6:79887867-79887889 GTGACTTTCTGGCACTACTGGGG - Intergenic
1013378202 6:109539997-109540019 GTGTCATACTGCCCCTACTGGGG + Intronic
1014690890 6:124562255-124562277 GTGTCTCAATGGCACTAGTGTGG - Intronic
1015169292 6:130233190-130233212 GTGAATTACTGGACCTAGTGTGG - Intronic
1020318736 7:6925161-6925183 GTCACTCAATGACCCAACTGGGG - Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1023612759 7:41988082-41988104 GTGCCTTAAGGGCCCTGCTATGG + Intronic
1024517635 7:50272961-50272983 TTGACTTAATGGGGCTGCTGAGG + Intergenic
1034761498 7:153676569-153676591 ATGACTCAATGGTCCTCCTGGGG + Intergenic
1034761692 7:153678731-153678753 CTGACTCAATGGTCCTCCTGGGG + Intergenic
1034933988 7:155186782-155186804 GTGGCTTAGTGGCCCAGCTGGGG - Intergenic
1040920831 8:52614681-52614703 GGGACCTAATGGCCCAGCTGTGG - Intergenic
1186274164 X:7922003-7922025 ATGACTTCATGGCCCGACTAAGG - Exonic
1194681430 X:96858710-96858732 GTGACTTACAGGCAATACTGTGG + Intronic
1194930335 X:99880455-99880477 GTGAAGCAATGGCCCAACTGGGG + Intergenic