ID: 903368717

View in Genome Browser
Species Human (GRCh38)
Location 1:22820625-22820647
Sequence TGCACTCCATGCACTCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903368715_903368717 16 Left 903368715 1:22820586-22820608 CCAGGAGGTTGAGGCTGCAGTGA 0: 4438
1: 17639
2: 70139
3: 168694
4: 176770
Right 903368717 1:22820625-22820647 TGCACTCCATGCACTCCAGCCGG 0: 1
1: 0
2: 0
3: 16
4: 159
903368714_903368717 17 Left 903368714 1:22820585-22820607 CCCAGGAGGTTGAGGCTGCAGTG 0: 3906
1: 17622
2: 57974
3: 156255
4: 235270
Right 903368717 1:22820625-22820647 TGCACTCCATGCACTCCAGCCGG 0: 1
1: 0
2: 0
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903368717 Original CRISPR TGCACTCCATGCACTCCAGC CGG Intronic
901375072 1:8832155-8832177 TCCAGTCACTGCACTCCAGCCGG + Intergenic
901438503 1:9263752-9263774 GGCCCTCCCTGCCCTCCAGCTGG + Exonic
902117875 1:14136844-14136866 TAGTCCCCATGCACTCCAGCAGG - Intergenic
903368717 1:22820625-22820647 TGCACTCCATGCACTCCAGCCGG + Intronic
903399471 1:23030004-23030026 TCCACTCCATGCCCTCCATTTGG + Intronic
906108373 1:43307888-43307910 TGCACTCCATGCCACCCAGAGGG - Exonic
907577355 1:55539306-55539328 AGTACTCCATGCACACCAGCTGG + Intergenic
908325220 1:63017071-63017093 TCCACTCCCTGGACTCCATCTGG + Intergenic
908527768 1:65003847-65003869 TGCAATCCATGCACTCAAATAGG + Intergenic
915764512 1:158349304-158349326 CGCCCACCCTGCACTCCAGCTGG + Intergenic
918053124 1:180991782-180991804 GGCTCTCTAAGCACTCCAGCAGG - Intronic
918122979 1:181556241-181556263 TGCACCCCATCCACCCCAGAGGG - Intronic
919310002 1:195895111-195895133 TTCTCTCCAAGCCCTCCAGCTGG - Intergenic
924299730 1:242625274-242625296 TGCACTCCAGGCTCGGCAGCAGG - Intergenic
924797668 1:247303990-247304012 TGCCCTCCATGCAGTCCACAGGG - Intronic
1062967937 10:1624472-1624494 TGCACACCATGGTCCCCAGCCGG - Intronic
1063071949 10:2675668-2675690 TGCACTCCATGCATCAGAGCTGG + Intergenic
1065483534 10:26216381-26216403 GGCAGACCATGCACGCCAGCTGG - Exonic
1066362977 10:34748769-34748791 TGCAGTGCCTGCACTGCAGCAGG - Intronic
1070453086 10:76581470-76581492 CAAACTGCATGCACTCCAGCTGG + Intergenic
1070523545 10:77275689-77275711 TGCACATCATCCACTCCTGCAGG + Intronic
1072613711 10:97035704-97035726 TGGACTCCAGGCCCTCTAGCTGG + Intronic
1073345118 10:102777052-102777074 AGCACTGCATTCATTCCAGCCGG + Intronic
1076413007 10:130265084-130265106 TGCACTCCAGCCATGCCAGCAGG + Intergenic
1076531787 10:131149803-131149825 TTCACTCCCTGCACCCCCGCTGG - Intronic
1079517138 11:21282432-21282454 ATCATACCATGCACTCCAGCAGG + Intronic
1081110862 11:39131365-39131387 TGGACTCCATGCTTTTCAGCTGG + Intergenic
1081651785 11:44828723-44828745 GGCTCTCCATTCACTGCAGCTGG - Intronic
1082904713 11:58293141-58293163 TGTAATCCCTGCACTCCAGGAGG - Intergenic
1084590247 11:70086039-70086061 TGCCGTCCCTGCACTCCATCAGG + Intronic
1084616129 11:70237085-70237107 GCCACTCACTGCACTCCAGCTGG + Intergenic
1086861717 11:91932254-91932276 TGCACTGGATGCCCTCCAGGAGG + Intergenic
1089004736 11:115082000-115082022 TGCACTCCATGCAGGGCAGTTGG - Intergenic
1089739284 11:120571330-120571352 TGCACACCCTGCACTCTGGCTGG + Intronic
1090523404 11:127503385-127503407 TTCACTCCATGCACTGGAGCTGG - Intergenic
1090839590 11:130476513-130476535 TGCACTCCATGTACTGCAGAAGG + Exonic
1091410078 12:233437-233459 TGCACTCCCTCTACTACAGCGGG - Intronic
1096601698 12:52734392-52734414 TGCATTCCATGCAGTGTAGCTGG - Intergenic
1098077030 12:66743116-66743138 TGCAGTCCTTGCATTCTAGCTGG - Intronic
1099051171 12:77783280-77783302 TGGTCTCCATGTACTCCATCTGG - Intergenic
1099058539 12:77876341-77876363 TGCACTCAAGGCACTTGAGCAGG + Intronic
1101723276 12:107369441-107369463 ATCACACCATTCACTCCAGCCGG - Intronic
1102487204 12:113266524-113266546 TGAAGGCCATTCACTCCAGCAGG - Intronic
1103444006 12:120982113-120982135 ATCGCGCCATGCACTCCAGCCGG - Intronic
1104869988 12:131988126-131988148 TGCAATCCCAGCACTCCAGGAGG - Intronic
1105247561 13:18666730-18666752 TGCACTCCACTTTCTCCAGCAGG - Intergenic
1105545876 13:21350701-21350723 TGGACCCACTGCACTCCAGCTGG + Intergenic
1106112761 13:26791648-26791670 TCCACTCCCTGCTCTCCAGCAGG + Intergenic
1108219239 13:48216471-48216493 TGCATCCCAGCCACTCCAGCTGG + Intergenic
1112307136 13:98285118-98285140 TGCATTCCATTCAATCAAGCAGG + Intronic
1113175795 13:107562419-107562441 TGCAGTCCCTGGACTCCTGCTGG + Intronic
1115398299 14:32933548-32933570 TCCACTCCAGGCTCGCCAGCCGG + Intergenic
1119997794 14:79272286-79272308 AGCACTGCATGAAGTCCAGCAGG - Intronic
1121866997 14:97371777-97371799 TCCCCTCCATGCAGTCCTGCTGG - Intergenic
1122086473 14:99310558-99310580 TGCACTTCATGCCTTCCATCTGG + Intergenic
1122161785 14:99790371-99790393 TGCATTCCATACAGTGCAGCTGG - Intronic
1123855780 15:24409707-24409729 TGCACTCCAGGCTCGCCAACAGG + Intergenic
1125842540 15:42817818-42817840 TGCACACGATTCTCTCCAGCTGG + Intronic
1127326263 15:57897983-57898005 TGGATTCCATGCAGTTCAGCAGG - Intergenic
1128944597 15:71811995-71812017 TGGACTCCATGCTGTCCAGGTGG - Exonic
1129469028 15:75740018-75740040 TGCTCTCCATGGACCACAGCTGG - Intergenic
1129970683 15:79775404-79775426 TGTACTGCCTGCAGTCCAGCGGG + Intergenic
1131438691 15:92442515-92442537 TGGACTCCATGCAGTTCAGATGG - Intronic
1133046107 16:3089246-3089268 CGCACTCCACGCACTCCTGCGGG + Exonic
1133559980 16:6941849-6941871 TGCACTTACTGCACTCCAGATGG - Intronic
1135157064 16:20061595-20061617 TCCTCTCAATGCAGTCCAGCAGG + Intronic
1135552972 16:23412497-23412519 AACAGTCCATGCTCTCCAGCTGG + Intronic
1138276299 16:55737333-55737355 CACACTCCATCCTCTCCAGCTGG - Intergenic
1138497360 16:57416506-57416528 TGCACTCACTGCAGTCCAGCTGG + Intergenic
1138504523 16:57471374-57471396 TGCACTGGAAACACTCCAGCAGG - Exonic
1139834143 16:69824652-69824674 TGCACTCTATCCACTCAAGAGGG - Intronic
1140731396 16:77859811-77859833 TGCAGTCCATCCACTGAAGCAGG + Intronic
1140869836 16:79096322-79096344 TGCAAGCCATGCTCTCGAGCTGG + Intronic
1140931933 16:79635822-79635844 TCCACTCCAGGCACCTCAGCTGG - Intergenic
1142674463 17:1505168-1505190 TTGACTCACTGCACTCCAGCTGG - Intronic
1144760038 17:17701923-17701945 TGCCCTCCAAGGACTCCAGTCGG + Intronic
1145413661 17:22694997-22695019 TACACTGCATACACTGCAGCTGG - Intergenic
1147539627 17:41346449-41346471 TGCAGTCCTCGCTCTCCAGCAGG + Exonic
1147541577 17:41364780-41364802 TGCAGTCCTCGCTCTCCAGCAGG + Exonic
1147545053 17:41394849-41394871 TGCAGTCCTCGCTCTCCAGCAGG + Exonic
1147885280 17:43680104-43680126 TGCACTGCATGCAGGCCAGAGGG - Intergenic
1152251815 17:79216402-79216424 TCCACTCCAGGCCCTCCAGGTGG - Intronic
1154172530 18:12061743-12061765 TGCACTCCCTGTGCTCGAGCAGG - Intergenic
1154268861 18:12901979-12902001 TGCAGTTCATGCCCTCCATCTGG + Intronic
1154441278 18:14392391-14392413 TGCACTCCACTTTCTCCAGCAGG + Intergenic
1161479918 19:4505337-4505359 TGCCCTCCGGCCACTCCAGCAGG + Intronic
1161531671 19:4793363-4793385 TGCACTCCACTTTCTCCAGCAGG - Exonic
925170451 2:1747049-1747071 TGCTATCCATACACTCCAGTGGG + Intergenic
926636157 2:15181957-15181979 TGCAGTCCTTGCCCTCCAGCAGG + Intronic
926672256 2:15587460-15587482 TGAACACCATGTCCTCCAGCAGG - Intergenic
929574081 2:43041387-43041409 TGCACTCTAAGCACCACAGCAGG - Intergenic
929588738 2:43131965-43131987 TGAACTCCATGAGCTCCAGGAGG - Intergenic
930827525 2:55709259-55709281 TGACCCCAATGCACTCCAGCTGG + Intergenic
936486025 2:112926475-112926497 TGCAATCCTAGCACTCCAGGAGG - Intergenic
937815217 2:126243772-126243794 TGATCTCCATGCACTGCATCAGG + Intergenic
938297309 2:130186160-130186182 TGGCCTCCATGCCCCCCAGCCGG - Intronic
939738809 2:145881224-145881246 TGCCCACCCTGAACTCCAGCTGG + Intergenic
942618256 2:177817466-177817488 TTCACTCCAGGCGCTCTAGCTGG - Intronic
942778888 2:179617280-179617302 TGCACCTGATGCACCCCAGCTGG + Intronic
943564829 2:189505135-189505157 CGCACTCCATGGACACCTGCAGG + Intergenic
948630963 2:239302550-239302572 AGCACTCCAAACACTGCAGCGGG + Intronic
1170569239 20:17623549-17623571 TGCGCTCCATGCTGTCCAGGTGG - Intronic
1172897219 20:38308802-38308824 TTCACTCCATCCATTCCAGGAGG - Intronic
1174124803 20:48296430-48296452 TCCACGCCATGAGCTCCAGCTGG - Intergenic
1175480609 20:59308149-59308171 TGCACTCCAAGCAAACCAGAAGG + Intronic
1175824813 20:61931074-61931096 TGCCCCCCATGCACCCCACCAGG - Intronic
1176229735 20:64026084-64026106 TGCACACCATGCACCCCAGACGG - Intronic
1176454781 21:6898783-6898805 TGCACTCCACTTTCTCCAGCAGG - Intergenic
1176832953 21:13763831-13763853 TGCACTCCACTTTCTCCAGCAGG - Intergenic
1179563410 21:42231572-42231594 TGCCTTCCATGCACTTTAGCTGG - Intronic
1181135708 22:20764812-20764834 TGTACCTCATGTACTCCAGCCGG + Exonic
1181182331 22:21077140-21077162 TGGCCTCCATGCCCTCCAGCTGG + Intergenic
1181636045 22:24175364-24175386 GGCCCTCCATCCTCTCCAGCAGG - Intronic
1185215805 22:49599396-49599418 TGCCCTCCCAGCGCTCCAGCCGG - Intronic
1185348326 22:50320338-50320360 TGCACTCCCAGCACTTCAGGAGG - Intronic
950639508 3:14339790-14339812 CGCATTGCATGCACTCCAGCTGG - Intergenic
953296316 3:41721406-41721428 GCCACTGCATGCACTCCAGCAGG - Intronic
953621293 3:44535152-44535174 TGCCCTCCAGGCACTGGAGCAGG + Intergenic
953889943 3:46744080-46744102 TGCAGCCCATGAACTTCAGCAGG - Exonic
954589819 3:51773778-51773800 TGCATTACATGGACTCCAGCAGG + Intergenic
955078020 3:55632157-55632179 TTCCCTCTATGCACACCAGCAGG + Intronic
955989981 3:64616137-64616159 GGCACTACATTCACTCCTGCTGG + Exonic
960252774 3:115474732-115474754 TGCACTCCAAGCACTGGAGTTGG - Intergenic
961794892 3:129402424-129402446 TGCACTCCTGGCACAACAGCTGG - Intronic
962292916 3:134152203-134152225 AGCACTCCATGCGCTACAGGTGG - Intronic
962708823 3:138068723-138068745 TGCACTGCAGGCAGTCCTGCAGG + Intronic
967999590 3:195195738-195195760 TGCTCTTCCTGCACCCCAGCTGG + Intronic
968978602 4:3834782-3834804 TGCACCCCTTGCCCTGCAGCTGG - Intergenic
972791618 4:42376992-42377014 TGCAATCCATTATCTCCAGCTGG - Intergenic
974647143 4:64709731-64709753 TCGCCTCAATGCACTCCAGCCGG + Intergenic
976411486 4:84718011-84718033 GCCACTCACTGCACTCCAGCCGG + Intronic
985491053 5:179717-179739 TCCACTCTCTGCACTCCACCTGG + Intronic
985606101 5:858806-858828 TGCAATCCCTGCACTCCTGAAGG - Intronic
990027641 5:51214648-51214670 TTCCCTACATGCATTCCAGCTGG - Intergenic
991163696 5:63536046-63536068 TGGACTTCATGCCCTCCAACAGG + Intergenic
991904932 5:71500368-71500390 ATCACACCATGCACTCCAGCTGG - Intronic
992733764 5:79698501-79698523 TTCACTACATGCAAGCCAGCAGG + Intronic
994400398 5:99272672-99272694 TGCACTCTCTGCACTCCCGTGGG + Intergenic
994908412 5:105869349-105869371 TGCACTCCCATAACTCCAGCAGG - Intergenic
995151678 5:108854897-108854919 TGCCCCCACTGCACTCCAGCTGG + Intronic
995462884 5:112420533-112420555 TGCAATCTGTGCTCTCCAGCTGG + Intergenic
1000411095 5:160935651-160935673 AGCACTCCATGCAGTCCCACAGG + Intergenic
1002366678 5:178717942-178717964 TTTCCTCCATGCACTCCAGCTGG - Intronic
1004705786 6:18122519-18122541 AGCACACCTTGCACTCGAGCAGG + Exonic
1007341641 6:41194424-41194446 TACCCTCCATGCCCTCCATCAGG - Exonic
1007709832 6:43815443-43815465 TGCACTCCATCAAGACCAGCTGG - Intergenic
1008437807 6:51496680-51496702 TGGACTCCATCCACTTCAGAAGG - Intergenic
1011493935 6:87920491-87920513 TTCACGCCATGCACACCAGCAGG + Intergenic
1011898662 6:92264041-92264063 AACACTCCTTGCACTACAGCCGG - Intergenic
1012367116 6:98455113-98455135 TGCAATGCATGCATTTCAGCAGG - Intergenic
1012579089 6:100842712-100842734 TGCAATCCCTGCACTTCAGGAGG + Intronic
1015456757 6:133435302-133435324 TGCACTGCAAGCACTCATGCTGG + Intronic
1015577916 6:134692189-134692211 TGCACACCATGCACGACAACAGG + Intergenic
1016020368 6:139230573-139230595 TGTGCTCCATGCTCTGCAGCTGG + Intergenic
1019006605 6:168803116-168803138 TGCACACCATGCACACCCACGGG + Intergenic
1026109880 7:67450624-67450646 GTCACACCCTGCACTCCAGCTGG - Intergenic
1027050269 7:75017404-75017426 GCTACTCCAGGCACTCCAGCCGG + Intronic
1031948483 7:127866570-127866592 TCCACTCCATGCACTCAACAAGG + Intronic
1033368977 7:140692004-140692026 TGCACTCCAAGCACTTCACTAGG + Intronic
1037212381 8:16406558-16406580 TACACTCCATGTGCTCTAGCAGG + Intronic
1037712031 8:21362451-21362473 ACCACTCCAGGCTCTCCAGCAGG - Intergenic
1041235224 8:55794310-55794332 TGCAATCCCTGCACTCTAGGAGG - Intronic
1041372124 8:57172756-57172778 TGCTCGCCATGCACTCCTTCAGG + Intergenic
1047143299 8:122167124-122167146 TTAACTCCATGCAACCCAGCAGG - Intergenic
1048276251 8:133068216-133068238 AGCACTCCATGCCCTGCAGGAGG + Intronic
1049021561 8:139960796-139960818 TGCACTCCTGCCACTGCAGCTGG + Intronic
1049643060 8:143724045-143724067 GCCTCTCCATGGACTCCAGCTGG + Exonic
1049658215 8:143808231-143808253 TGAACTCCGTGCCCGCCAGCAGG + Intronic
1057383117 9:94586337-94586359 TGCACTCCAGCCTGTCCAGCCGG + Intronic
1061150757 9:128826784-128826806 GCCACTGCATGCACTCCAGCCGG + Intronic
1061499576 9:130994128-130994150 TGAAGTCCAGGCTCTCCAGCAGG + Intergenic
1186879879 X:13854193-13854215 GGCACTCCAGGCACTGCTGCAGG + Intronic
1197744378 X:129921314-129921336 TGCACTTCATTCACTACATCAGG - Exonic
1201096869 Y:10628166-10628188 TCCACTACATGCACTCCACTAGG + Intergenic
1201097690 Y:10646340-10646362 TCCACTACATGCACTCCACTAGG + Intergenic
1202102790 Y:21328366-21328388 TGCACACCATACAATCCAGAGGG + Intergenic