ID: 903369895

View in Genome Browser
Species Human (GRCh38)
Location 1:22828459-22828481
Sequence GACCCAATCCTTGTTCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903369891_903369895 18 Left 903369891 1:22828418-22828440 CCTGGAGCCTCTTCTACATCTGC 0: 1
1: 0
2: 3
3: 18
4: 237
Right 903369895 1:22828459-22828481 GACCCAATCCTTGTTCTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 65
903369890_903369895 28 Left 903369890 1:22828408-22828430 CCTAGCAGCTCCTGGAGCCTCTT 0: 1
1: 0
2: 3
3: 41
4: 321
Right 903369895 1:22828459-22828481 GACCCAATCCTTGTTCTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 65
903369893_903369895 11 Left 903369893 1:22828425-22828447 CCTCTTCTACATCTGCACGGATG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 903369895 1:22828459-22828481 GACCCAATCCTTGTTCTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903369895 Original CRISPR GACCCAATCCTTGTTCTGGC AGG Intronic
903369895 1:22828459-22828481 GACCCAATCCTTGTTCTGGCAGG + Intronic
912517958 1:110227645-110227667 GCCCAAAGCCTTGCTCTGGCTGG + Intronic
922723355 1:227910060-227910082 TAAACAATCCTTCTTCTGGCTGG + Intergenic
1063874662 10:10461495-10461517 AACCCCATCCTTCTTCTGTCAGG - Intergenic
1067074414 10:43166370-43166392 GACGCAACCCTTGCTATGGCTGG - Intronic
1070421099 10:76238177-76238199 GTCCCCATCCTTGTTCTAGAGGG + Intronic
1070992107 10:80741553-80741575 GACCCAATCCTCCATCTGGAGGG + Intergenic
1071668087 10:87579775-87579797 GACCCACTCATCATTCTGGCTGG - Intergenic
1075814177 10:125251959-125251981 TCCCCATTTCTTGTTCTGGCAGG + Intergenic
1076237650 10:128877909-128877931 GTTCCAATCCTTATTCTTGCAGG + Intergenic
1081431178 11:42978189-42978211 GACCACAGTCTTGTTCTGGCTGG + Intergenic
1085506970 11:77066486-77066508 CACCAAGTCCTGGTTCTGGCAGG + Intergenic
1088993422 11:114974308-114974330 GACACAATCCTTGTTCTCAAGGG + Intergenic
1091200953 11:133780902-133780924 GACCCAATCCCTGTTTTTCCAGG + Intergenic
1101411553 12:104472926-104472948 GCCCCACTCCCTGCTCTGGCAGG - Intronic
1101426548 12:104592933-104592955 GACCCAGTTCTTCTCCTGGCCGG + Intronic
1104807057 12:131596377-131596399 GTTCAAATCCTTGTTCTGCCAGG - Intergenic
1120068800 14:80078978-80079000 GACCCAATCCTTGCTCTCAATGG + Intergenic
1124085679 15:26548677-26548699 TGCCCAATACTGGTTCTGGCAGG + Intronic
1126556305 15:49991827-49991849 GACCTCATCCTTGTGCTGGATGG + Intronic
1128648272 15:69392817-69392839 GTCCTCATCCTTGTCCTGGCTGG - Intronic
1132072269 15:98788714-98788736 GTCCTAATCCCTGTTCTGGCCGG + Intronic
1132738281 16:1397962-1397984 GACCCCATCCTGGCACTGGCCGG - Intronic
1139921464 16:70463234-70463256 GACACTGTCCTTGTACTGGCAGG - Exonic
1143644096 17:8218572-8218594 GACCCAAACCTTGTTCCTGAAGG - Intergenic
1146386778 17:32383869-32383891 GTCCCACTCCTTGTCCAGGCTGG - Intergenic
1149556209 17:57575173-57575195 GAGCAGATCCCTGTTCTGGCTGG + Intronic
1151231458 17:72688208-72688230 GGCCCTATTCTTGTTCTGCCGGG - Intronic
1153256420 18:3176198-3176220 CACACAATTCTTGTTCTTGCAGG + Intronic
1153607789 18:6852687-6852709 GACCTAATCCTTATTCTTACAGG + Intronic
1156696755 18:39776730-39776752 GACCCAATCCATGTTAGAGCCGG + Intergenic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1166666610 19:44684032-44684054 GACCCCTTCCCTGTTCAGGCAGG + Exonic
933836771 2:86252163-86252185 TGCCCAATCCTTGTTCTTGCTGG + Intronic
936748280 2:115608089-115608111 GATTAAATCCTTATTCTGGCTGG + Intronic
944153870 2:196591339-196591361 GACTCAAACCGTCTTCTGGCTGG - Intronic
946111351 2:217420647-217420669 GACCCAACACTTGACCTGGCTGG + Intronic
947718404 2:232352979-232353001 GGCCCAGGCCTTCTTCTGGCAGG - Intergenic
947724606 2:232388905-232388927 GCCCCAAGCCTTCTTCTGGCAGG - Intergenic
948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG + Intergenic
1181594167 22:23903558-23903580 TCCCCAGTCCCTGTTCTGGCAGG - Intergenic
949365577 3:3276829-3276851 GAGCCAATCATTGTTCTGAGAGG - Intergenic
950072482 3:10163955-10163977 GACAAAATCCTTGTCCTGGAGGG - Intergenic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
950718614 3:14866867-14866889 GACCCTGGCCTTGCTCTGGCTGG - Intronic
953333495 3:42073905-42073927 GACCCCATCATTGTCCTAGCTGG + Intronic
954369691 3:50163693-50163715 GCCCCATGCCTTGCTCTGGCTGG - Intronic
954468435 3:50672505-50672527 GACCATTGCCTTGTTCTGGCTGG - Intergenic
954746900 3:52792538-52792560 AAACCAGTCCTTGTTCTGTCTGG - Intergenic
960665781 3:120107560-120107582 AACACAATCCTAGTTTTGGCAGG - Intergenic
962106338 3:132394412-132394434 GACTTAATTCTTGTTCTGGCTGG - Intergenic
965327022 3:167319196-167319218 GAATCAATATTTGTTCTGGCTGG - Intronic
966911633 3:184562960-184562982 GACCCAAGCCCTGCTCTAGCAGG - Intronic
967814623 3:193788383-193788405 GCCCCATTCCTTCTTCTTGCTGG - Intergenic
967910531 3:194538865-194538887 GACTCAAACCTTGCTATGGCAGG - Intergenic
972140137 4:35948434-35948456 AACCCAATCTGTGTTCTGGAAGG + Intronic
972860299 4:43160396-43160418 AACACTATCCTTGTTCTTGCTGG - Intergenic
982231829 4:153215554-153215576 ATCCCAATTCTTGTTCTGGATGG + Intronic
998265940 5:140667941-140667963 GACCCAATCTTTGTCCAGGCTGG + Intronic
1000399439 5:160811100-160811122 GACCCAGTCCCAGTCCTGGCAGG + Intronic
1000802250 5:165742532-165742554 GACACAAATCTTGTTCTGGAAGG - Intergenic
1001030886 5:168261938-168261960 GACCCAACACTAGTTCTTGCAGG + Intronic
1006861109 6:37171806-37171828 GCCCCCATCCTTTTACTGGCGGG - Intronic
1008518103 6:52337165-52337187 GAACCAATCGTTGTTCTTTCAGG - Intergenic
1018310124 6:162499997-162500019 GACCAAGTCCTTGTTCTAGATGG - Intronic
1021111132 7:16696008-16696030 GTCCCAGTCCCTGTGCTGGCTGG - Intronic
1026413524 7:70153891-70153913 AGCCCAATCCTTTTTTTGGCTGG + Intronic
1045294042 8:100858759-100858781 GATCCAAGCCTTGTTCTGACAGG - Intergenic
1052340871 9:27363044-27363066 GACCCACTCCCTTTCCTGGCAGG + Intronic
1060014840 9:120078245-120078267 GACCAAATCCTTGCTCTTGTGGG + Intergenic
1061842635 9:133368230-133368252 AAGCCAACCCTTGTTCTGTCAGG - Intronic
1189938764 X:46098563-46098585 CACACAATCCTGGTGCTGGCAGG + Intergenic
1194539938 X:95157291-95157313 GACCCAAGCCTGGTGGTGGCGGG - Intergenic