ID: 903369895

View in Genome Browser
Species Human (GRCh38)
Location 1:22828459-22828481
Sequence GACCCAATCCTTGTTCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903369893_903369895 11 Left 903369893 1:22828425-22828447 CCTCTTCTACATCTGCACGGATG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 903369895 1:22828459-22828481 GACCCAATCCTTGTTCTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 65
903369890_903369895 28 Left 903369890 1:22828408-22828430 CCTAGCAGCTCCTGGAGCCTCTT 0: 1
1: 0
2: 3
3: 41
4: 321
Right 903369895 1:22828459-22828481 GACCCAATCCTTGTTCTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 65
903369891_903369895 18 Left 903369891 1:22828418-22828440 CCTGGAGCCTCTTCTACATCTGC 0: 1
1: 0
2: 3
3: 18
4: 237
Right 903369895 1:22828459-22828481 GACCCAATCCTTGTTCTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903369895 Original CRISPR GACCCAATCCTTGTTCTGGC AGG Intronic