ID: 903370515

View in Genome Browser
Species Human (GRCh38)
Location 1:22832152-22832174
Sequence CAGCAGGAATAGCAGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 411}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903370506_903370515 16 Left 903370506 1:22832113-22832135 CCAGAAAGTAGGGACAAGAGACT 0: 1
1: 0
2: 0
3: 12
4: 148
Right 903370515 1:22832152-22832174 CAGCAGGAATAGCAGGAACAGGG 0: 1
1: 0
2: 5
3: 39
4: 411
903370511_903370515 -7 Left 903370511 1:22832136-22832158 CCAGGCTGGGGTGCAACAGCAGG 0: 1
1: 2
2: 203
3: 2565
4: 28612
Right 903370515 1:22832152-22832174 CAGCAGGAATAGCAGGAACAGGG 0: 1
1: 0
2: 5
3: 39
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903370515 Original CRISPR CAGCAGGAATAGCAGGAACA GGG Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900779128 1:4606144-4606166 CAGCAGATACAGCAGGTACAGGG - Intergenic
903249663 1:22043554-22043576 CAGCAGGTAAACCAGGAACACGG + Intergenic
903370515 1:22832152-22832174 CAGCAGGAATAGCAGGAACAGGG + Intronic
903808708 1:26022696-26022718 CAGCAGGACAAGCAGGAGCCAGG - Exonic
904400903 1:30256074-30256096 GAGCAGGAAGAGCAGGGACCCGG - Intergenic
905043137 1:34976737-34976759 CAGCAGGAACCCCAGGACCATGG + Intergenic
905043929 1:34981896-34981918 CAGCTGTCACAGCAGGAACATGG - Exonic
905197873 1:36295259-36295281 CAGCAGGAGTGGCAGAAACTAGG - Intronic
905919861 1:41712232-41712254 TGGCAGGAGAAGCAGGAACAGGG + Intronic
906105640 1:43290508-43290530 CAGAAGGAAGAGAAGGGACAAGG + Intergenic
907048507 1:51314498-51314520 GAACAGGAAAAGCAGGAAAAGGG - Intronic
907951011 1:59184220-59184242 AAGCAGAAATAGCAGAAGCAAGG - Intergenic
908920360 1:69183656-69183678 CAGCAGGAATGGCAGAAGCCAGG - Intergenic
909256363 1:73428476-73428498 CATCAGGAAGACCAGGAAGATGG - Intergenic
909498312 1:76304516-76304538 CAGGAGGAGCAGCATGAACAAGG + Intronic
909751080 1:79161875-79161897 CAGAGGGAATAGCAGGTAGAAGG + Intergenic
910131475 1:83912443-83912465 CATCAGGAATAGGAGGCATATGG - Intronic
910293794 1:85624333-85624355 CAGCATGAAAAGCAGGAACTTGG + Intergenic
910557169 1:88547288-88547310 GAGCAGGAATAACAAAAACATGG + Intergenic
911221274 1:95250068-95250090 CAGTTGGTATAGCAGCAACAGGG - Intergenic
912730452 1:112097877-112097899 AAGCAGGAATATTAGAAACAAGG + Intergenic
914510574 1:148328977-148328999 CAGCGGGAGTAGAAGGGACACGG - Intergenic
915950420 1:160186584-160186606 CAGAAGGGAAAGCAGGGACAAGG - Intronic
915968133 1:160330149-160330171 CAGCTGGAATAGCATGAATTGGG + Intronic
917442553 1:175080140-175080162 CTGCAGGCAGAACAGGAACAGGG - Intronic
917457906 1:175201382-175201404 CAACAGCAACAGCAGGAAAAGGG - Intergenic
917719625 1:177774808-177774830 CACCAGGCATGGCAGGATCAGGG + Intergenic
919402350 1:197135164-197135186 TGGAAGGAAAAGCAGGAACAGGG - Exonic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921842768 1:219846282-219846304 CAGGAGGATTAGGAGGAAGATGG + Intronic
924475746 1:244380809-244380831 CATCAGGAAGATCAGGAAAAGGG + Intronic
1062982340 10:1736345-1736367 CCCCAGGAATATCAGTAACAAGG + Intronic
1063475899 10:6328880-6328902 CAGCAGCTGTTGCAGGAACATGG - Intergenic
1063688204 10:8258509-8258531 CAGCAGGAACTGCAGGCACTAGG - Intergenic
1064127471 10:12675893-12675915 CAGAAAGAATATCAGAAACAAGG - Intronic
1066124561 10:32328017-32328039 AAGCAGGAATAAAAGGAAGAGGG + Intronic
1066399390 10:35060344-35060366 CACCAGGAAAGGCAGGAAGATGG + Intronic
1067437324 10:46287288-46287310 CAGCAGGAAGACCAGGAAGTAGG - Exonic
1067563855 10:47322694-47322716 CAGCAGGGACAGCAGGGGCAGGG - Exonic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1069196476 10:65556955-65556977 CAGAATGAAAAGCAGGAAAAGGG + Intergenic
1069860999 10:71471717-71471739 CCGCAGGAATGGCAGGAACAAGG - Intronic
1070853160 10:79584163-79584185 CAGCAGGAGAAGCAGGAGAAGGG + Intergenic
1070887922 10:79921142-79921164 CAGCAGGAGAAGAAGGAAAAGGG - Intergenic
1072033279 10:91541252-91541274 CAGCAACATTAGCTGGAACAGGG + Intergenic
1072422039 10:95297333-95297355 CAGCAGGGACAGAATGAACAAGG + Intergenic
1072440297 10:95448309-95448331 CAGCTGGAAAACCAGGAAAATGG - Intronic
1072560745 10:96571413-96571435 CAGCAGGAATAGCAGAAGCTAGG + Intronic
1073606638 10:104902214-104902236 CATCAGGACTGGCAGCAACATGG - Intronic
1073724338 10:106212381-106212403 CAGTAGGAAATGAAGGAACAAGG + Intergenic
1074213563 10:111361696-111361718 CAGCAGCATTAGCATGACCAGGG + Intergenic
1074740412 10:116480792-116480814 CATCAGTTAAAGCAGGAACAGGG - Intergenic
1074944124 10:118264704-118264726 TAGCAGGAAGAGAAGGAGCAGGG + Intergenic
1075157215 10:119988368-119988390 CAGTAGGAATAGAAGGAATGGGG + Intergenic
1075485606 10:122819779-122819801 CATCAGGAATAGCTGGAACCAGG - Intergenic
1075852659 10:125601937-125601959 GAGCAGCAAGAGCAGGGACAAGG - Intronic
1076623913 10:131810164-131810186 CAGGAGGAAAAGCAGGATGATGG + Intergenic
1076944179 10:133633027-133633049 CAGCATGAACATCAGAAACATGG + Intergenic
1079743453 11:24094268-24094290 CAGCAAGAAAGGCAGGAATAAGG + Intergenic
1080018432 11:27532518-27532540 CAGCAGGAATAGCTGGTGCTTGG - Intergenic
1080425856 11:32153725-32153747 AAGCAGGAAGAGCTGGAACTGGG + Intergenic
1080862956 11:36166104-36166126 CAGCGGAAAGAGCAGGAACCAGG - Intronic
1081761961 11:45582879-45582901 CAGCAGAAATAGGAGGAAGGTGG - Intergenic
1081819949 11:45983064-45983086 CAGTAGGGAAAGCAGGAGCAAGG + Intronic
1081979800 11:47259237-47259259 CAGGAGGAATGTCAGGCACAGGG - Exonic
1082669021 11:56010871-56010893 AACCAGGAAAACCAGGAACATGG + Intergenic
1082683702 11:56211722-56211744 CACCAGGAAGACCAGGAAGAGGG + Intergenic
1082926317 11:58551123-58551145 GAGCAGGAATTGCAGGACCTTGG - Exonic
1083355148 11:62060729-62060751 CAGGAGGAATTGCTTGAACACGG - Intergenic
1083414386 11:62516023-62516045 CAGAACTAATATCAGGAACATGG + Exonic
1083491855 11:63019563-63019585 CAGCAGCCACAGCAGGAGCAGGG - Intergenic
1083690185 11:64403395-64403417 CAGCAGACAAAGCAGAAACATGG - Intergenic
1084408832 11:68994373-68994395 CAGCAGGAACAGCGGGGACCCGG + Intergenic
1084578995 11:70010738-70010760 CAGGAGGAATAGCAGGGACCAGG - Intergenic
1084804456 11:71569338-71569360 CAAAAGGAACAGCAGGAAAAGGG - Intergenic
1084805999 11:71579290-71579312 CAAAAGGAACAGCAGGAAAAGGG + Intergenic
1085699390 11:78732611-78732633 GAGCAGGAAGAGCAGGAACCAGG + Intronic
1085872422 11:80366421-80366443 CAGCAACAATAGCAAAAACAAGG + Intergenic
1086074991 11:82841144-82841166 CAGCAGGAATAACAGGGCCTGGG + Intronic
1086140436 11:83492861-83492883 CAGCAGGAATAGGTGGAAGCAGG - Intronic
1086194309 11:84118692-84118714 CAGCAGCAGAAGCAGGAAGATGG + Intronic
1087265724 11:96058676-96058698 CAACAGGAATAGAAAGAACTGGG - Intronic
1087492860 11:98849897-98849919 CAGCAAGAATGTAAGGAACAGGG + Intergenic
1087549686 11:99633293-99633315 ATGCAGGCATAGCAGGAGCAAGG - Intronic
1088630114 11:111766358-111766380 CAGCAGGAGGAGAAAGAACATGG - Exonic
1089214715 11:116828875-116828897 CAGCAGGGATGGCAGGATGAGGG - Intergenic
1089508086 11:118978373-118978395 CAGGAGGAAGAGCAAGAAGATGG + Intronic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1089798967 11:121007907-121007929 CAGCAGGAAGATGAGGGACACGG + Intergenic
1089922662 11:122225026-122225048 CAGCAGCAGTAGAAGTAACAAGG + Intergenic
1090626756 11:128615034-128615056 AAGCAGGAATAGCATCAAGAAGG + Intergenic
1090896496 11:130980684-130980706 CAGCATGAACAGCAGCAGCAGGG + Intergenic
1091156627 11:133380777-133380799 GATCAGGAATAGCAAGAACCAGG - Intronic
1092210811 12:6645338-6645360 CTGCAGGAAGAGAAGGAAAATGG + Intronic
1092443823 12:8534588-8534610 AAGAAGGAAGAGCAAGAACATGG - Exonic
1093035380 12:14327630-14327652 CAGCAGGAAAAGCTGAAATATGG - Intergenic
1094331325 12:29297341-29297363 CACCAGAACTAGCAGGGACAAGG - Intronic
1096035175 12:48460850-48460872 ATGCAGGAAAAACAGGAACAAGG + Intergenic
1097013813 12:55971354-55971376 CAACAGGGAGAGCAGGAACCAGG - Intronic
1097426633 12:59453787-59453809 CAGGAGAAAGAGCAGGAATAAGG + Intergenic
1097686995 12:62700368-62700390 TAGGAAGAATAGCAGGACCAAGG - Intronic
1099438614 12:82672960-82672982 GAGGAGGAAGAGCAGGAAGAGGG - Intergenic
1100389709 12:94137810-94137832 CATCAGAACCAGCAGGAACAGGG - Intergenic
1100602351 12:96122726-96122748 CCCCAGGACTAGCCGGAACATGG - Intergenic
1101444239 12:104726034-104726056 AAGCAGGATTGGCAAGAACAAGG + Intronic
1101535964 12:105616737-105616759 CAGCAGGAAGAGGAAGAAGAGGG - Intergenic
1101834221 12:108283938-108283960 CAGCAGGAATAGCAAGTGCAAGG + Intergenic
1101906746 12:108832474-108832496 CTGCAGCAATAGCAGCAACGTGG + Intronic
1102115693 12:110401541-110401563 CAGGAGGAACAGCAAGTACAAGG + Intronic
1102417706 12:112778994-112779016 CAGAAGGACAATCAGGAACAGGG + Intronic
1102484484 12:113246724-113246746 CAGCTGGAAAGGCAGGAACTGGG - Intronic
1102570164 12:113822647-113822669 CTGGAGGGAGAGCAGGAACAGGG + Intronic
1102618360 12:114174201-114174223 CAGCATGCATAGCAGACACATGG + Intergenic
1103957181 12:124583747-124583769 CATCAGGAATATCAGGGGCAGGG + Intergenic
1104044593 12:125152925-125152947 CAGCAGTAGTAACTGGAACAAGG + Intergenic
1104285596 12:127421660-127421682 CAGCAGGAAGAGCAGATACACGG - Intergenic
1104625717 12:130352584-130352606 CAGGAGGAATCGCTGGAACTCGG + Intronic
1105000615 12:132687738-132687760 CCGCAGGAAGAGCAGGTACTGGG - Exonic
1106284016 13:28303294-28303316 CAGCTGGAATGGCAGAAACTGGG + Exonic
1106625117 13:31412699-31412721 CAGCAGCATTAGCAGGATCTGGG - Intergenic
1106677168 13:31973063-31973085 CAGCAGGAAAAATAGGAATAAGG + Intergenic
1108556222 13:51595508-51595530 CAACAGGCAGAGCAGGAGCAAGG - Intronic
1110420290 13:75299881-75299903 CAGGAGAAATACCAGGAAAATGG + Intronic
1110533764 13:76627472-76627494 CAGCAGGAGTGGCAAGAAGATGG + Intergenic
1111754667 13:92378161-92378183 TAGCAGGACTAGCAGGAAAGTGG - Intronic
1112259949 13:97868869-97868891 CAGCAGGAGTAGGAGGTGCAAGG + Intergenic
1112490511 13:99859090-99859112 AAGGAGGAGTAGCAGGAAGAAGG + Intronic
1112742206 13:102487593-102487615 CAGAAGGGATGGCAGGAACGTGG + Intergenic
1112779826 13:102887669-102887691 AAGAATGAATAGCAGGAAAATGG + Intergenic
1113354655 13:109566919-109566941 CAGCAGGAGCAGCAAGAACTAGG - Intergenic
1114945120 14:27671758-27671780 CAGTAGGAATAGGAGGAAATAGG - Intergenic
1115105610 14:29757980-29758002 CAGGAGGAATAGCAGACATAGGG + Intronic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1116742312 14:48772284-48772306 CAGCATGAAGAGAAGAAACAAGG + Intergenic
1117163400 14:53011012-53011034 CAGCAGCACTGGCTGGAACAAGG - Intergenic
1117798994 14:59424688-59424710 CAGCAGGAAAGGGATGAACATGG - Intergenic
1118090168 14:62466056-62466078 CATAAGGAATAGGATGAACAAGG + Intergenic
1118570326 14:67188494-67188516 GGGCAGGAAGAACAGGAACATGG + Intergenic
1119170221 14:72529292-72529314 CAGCAGTAATAGCAGATCCAAGG - Intronic
1119196177 14:72718188-72718210 CCACAGGAAGAGCAGGAACATGG - Intronic
1122412228 14:101531563-101531585 CAGCAGCAACTGCAGGAACCTGG - Intergenic
1202927045 14_KI270724v1_random:36051-36073 CAGCATGAACATCAGAAACATGG - Intergenic
1123498053 15:20850180-20850202 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1123555284 15:21423808-21423830 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1123591529 15:21861139-21861161 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1126705430 15:51401263-51401285 CAACAGGAATAGCAGATACTTGG - Intronic
1126829561 15:52587067-52587089 CAGCAGCAGTAGCAGGAGAAAGG + Intronic
1127532012 15:59852595-59852617 CAGCAGGGCTGGAAGGAACATGG + Intergenic
1127684909 15:61334162-61334184 CAGCAAGAAAAGAAGAAACAAGG + Intergenic
1127918723 15:63476521-63476543 CAGCTGGAAGACCAGGAGCAGGG + Intergenic
1128480579 15:68034290-68034312 CAGCAGGAAGAGGACGGACATGG + Intergenic
1128930628 15:71702130-71702152 CAGCAGGAAGAGCAAGCAGATGG - Intronic
1129161081 15:73748297-73748319 CAGCAGGCAGAGGAGGAAGATGG + Intronic
1129851092 15:78794410-78794432 CTGCAGGGATGGCAGGGACATGG - Intronic
1130032518 15:80328670-80328692 AAGCAGCAAAAACAGGAACAGGG - Intergenic
1130755366 15:86757229-86757251 CAGCAGTAATAGCAACATCAAGG - Intronic
1131072966 15:89477441-89477463 CCAGAGGAATAGCAGGAAGAAGG + Intronic
1131297921 15:91168415-91168437 CTGCAGGAATACCAGCCACAAGG - Intronic
1131569206 15:93516599-93516621 CAGCGGGGACAGCAGGAGCAGGG - Intergenic
1131573896 15:93567093-93567115 CAGCATGAGTTACAGGAACAGGG - Intergenic
1131876090 15:96807733-96807755 CAGCAGGGTTAGCAGGGGCAAGG - Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1202963630 15_KI270727v1_random:151017-151039 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132845723 16:2000003-2000025 CAGCAGCAGTAGCAGCAAGAAGG - Exonic
1134818621 16:17227415-17227437 GAGGAGGAGCAGCAGGAACAAGG + Intronic
1135165128 16:20132346-20132368 CAGTAGAAATATCTGGAACAAGG + Intergenic
1135709342 16:24701702-24701724 CAGAAGGGATAGCAGGGCCATGG - Intergenic
1138070568 16:53989233-53989255 CTTCAGGAATAGAATGAACAGGG + Intronic
1138149695 16:54644681-54644703 CAGCAGGAATGGCAGCACCCAGG - Intergenic
1138537660 16:57668373-57668395 GAGCAGGAGGAGCAGGAGCAGGG - Exonic
1138596445 16:58031655-58031677 CAGCAGGAGAAGCAGGAAGGAGG - Intronic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139445859 16:66998237-66998259 TGGCAGGAATATCAGGAGCACGG + Intronic
1141777963 16:86136815-86136837 CAGCAGGGAGAGCAGGAAGGAGG + Intergenic
1141992747 16:87619949-87619971 CACCAGGGACAGAAGGAACAGGG + Intronic
1142622503 17:1173793-1173815 CAGGAGGACCGGCAGGAACAGGG - Intronic
1143090791 17:4448180-4448202 CAGCAGGATAAGCAGGATCAAGG - Exonic
1145890791 17:28414043-28414065 CAGTAGGGAGAGCAGGCACAAGG + Intergenic
1147490630 17:40863048-40863070 CAGCAGAAATAGAAGGAATGGGG - Intronic
1149117829 17:53119383-53119405 CTTCAGGCATAGCAGGATCAAGG + Intergenic
1151271143 17:72996896-72996918 CAAAAGGAAGAGCAGTAACAAGG - Intronic
1151389012 17:73773038-73773060 CAACAGGATGAGCAGGATCAGGG + Intergenic
1152408731 17:80111554-80111576 TAGCAGGAATGGCAGAAACTGGG + Intergenic
1153193678 18:2570290-2570312 CAGCAGGAATATCAGGAAATTGG + Intronic
1153621125 18:6979051-6979073 CAGCAGAAAAAGCTGGAAAAAGG + Intronic
1154032376 18:10765224-10765246 CAGAAGAAATAGCAGGTCCAAGG + Intronic
1154353141 18:13603823-13603845 AAGCAGGGACAGCAGGGACAAGG + Intronic
1154456054 18:14526609-14526631 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1155210739 18:23598528-23598550 CAGCAGTAACATCAGGAATATGG - Intergenic
1156156561 18:34309591-34309613 CAGCAGCAATAGCAGCAAGATGG - Intergenic
1157227496 18:45880422-45880444 CAGCAGGGTTACCAGGAACCAGG - Intronic
1158311030 18:56158885-56158907 TAGCATGAATAGCATGAATAAGG + Intergenic
1159149671 18:64505145-64505167 AAGCTGGAATGGCTGGAACATGG - Intergenic
1159844121 18:73438272-73438294 CACCATGAACAGCAGGAGCAGGG - Intergenic
1161217302 19:3100893-3100915 CAGCAGGAAGGGCAGCCACAGGG - Intronic
1163231068 19:16002661-16002683 CAGCAGTTGTAGCAGGAATAAGG - Intergenic
1163780597 19:19245242-19245264 CAGCAGGAATTGCCAGAACCTGG + Intronic
1164500517 19:28815560-28815582 GAGCAGGAATAGAAGGGACCAGG - Intergenic
1164711662 19:30361282-30361304 CAGCAGCAGTAGCAGCATCAAGG - Intronic
1165714433 19:38035314-38035336 CAGCAAGAGGAGCAGGAACATGG - Intronic
1166256836 19:41612675-41612697 CAGCAAGAAATGCAGAAACAAGG + Intronic
1166293350 19:41877345-41877367 CAGCAGGAAGAGGAGGAAGATGG - Exonic
1166322673 19:42028366-42028388 CAGCAGGCAAAGCAGGAATATGG - Intronic
1167862832 19:52298746-52298768 GAGAAGGAATAGAAGGAAGAAGG + Intronic
925513879 2:4658142-4658164 CAGCAGGAGCAGCAGGGCCATGG - Intergenic
925754111 2:7117352-7117374 CACTAGGAATCGCAGGAACACGG + Intergenic
925971142 2:9107490-9107512 CAGCAGAAGTAGCACAAACAGGG + Intergenic
926951572 2:18249012-18249034 TAGCAGTAATAGCAGGTGCAAGG + Intronic
927106223 2:19829740-19829762 CAGAGGGAATAGCAGGTACCAGG + Intergenic
927860956 2:26559606-26559628 AAGAATGAATAGCAAGAACAAGG - Intergenic
928124737 2:28607492-28607514 GAGCAAGAATGGCAGGAAGAAGG + Intronic
928983506 2:37158479-37158501 CAGCAGCAATGGCAGTAGCAAGG + Intergenic
929244293 2:39685290-39685312 CAGAAGGAAGAGCATGCACAGGG - Intronic
930308782 2:49711768-49711790 CAGCAGGAAAAGGAGAAAAAAGG - Intergenic
930568592 2:53055488-53055510 CAGGAGGAAGAGCAAGAAGAGGG - Intergenic
931427693 2:62185907-62185929 CAGCATGAATTGCATGAAGAAGG - Intergenic
931465649 2:62484389-62484411 CAGTAGGTCCAGCAGGAACATGG - Intergenic
931701521 2:64913081-64913103 CAGCAGTAGTGGCAGGAAGAAGG + Intergenic
932317457 2:70795111-70795133 AAGCAGGAATAGCAAACACAAGG - Intergenic
934949527 2:98566953-98566975 CAGAAGGCCCAGCAGGAACACGG - Intronic
935794724 2:106630100-106630122 CAGCAGAAACAGCATGAAGAAGG - Intergenic
936416114 2:112313750-112313772 CATCCAGAATAGCATGAACATGG + Intronic
936824088 2:116559277-116559299 CAGCATAAATAGCAGAGACAAGG + Intergenic
937239009 2:120448217-120448239 GAGAAGGAATATCAGGATCAAGG - Intergenic
938475534 2:131608234-131608256 CAGCAGCAAGAGCAGGAGCAAGG - Intergenic
939209864 2:139160458-139160480 CAGCAGACATGGAAGGAACAGGG + Intergenic
939320055 2:140608297-140608319 CAGCAGGATTAGCAGCCACTTGG - Intronic
939732980 2:145808359-145808381 CAGCAGAAACAGCAGGGAGAGGG - Intergenic
940894659 2:159069252-159069274 CTGATGGAACAGCAGGAACAAGG - Intronic
940979641 2:159986885-159986907 AAGCAGAAATACCAGGCACAGGG - Intronic
941394791 2:164961210-164961232 CAGGAGGCAAAGCAGGAGCAAGG + Intergenic
941660621 2:168192225-168192247 CAGCAGGCAAAGAAGGAACATGG + Intronic
942642287 2:178072638-178072660 GAGCAGGAGTAGCAGGACCACGG - Exonic
942904765 2:181167061-181167083 CAGCTGGAATGGCTGGGACAAGG + Intergenic
944513068 2:200483713-200483735 CAACAGGAATAGCTGATACAGGG + Intergenic
944743660 2:202635320-202635342 CAGCAGCAGCAGCAGCAACATGG + Exonic
944881264 2:204015117-204015139 CAGCAGGAAGAAAAGGCACATGG + Intergenic
946242910 2:218367786-218367808 CAGCAGGAAGAGCAGGAAGTCGG - Exonic
946478223 2:220029434-220029456 GAGCAGCAATAGCAGGCTCAGGG + Intergenic
946498584 2:220221308-220221330 CAGCTGGAGTTGCAGAAACATGG - Intergenic
946542544 2:220700790-220700812 AAGCAGGAAGAGCAGGAGGAAGG - Intergenic
946827544 2:223694508-223694530 CAGCTGGGGTAGCAGGAAGAAGG - Intergenic
947506405 2:230711578-230711600 CAGAGGGAATAGCAGGACCAAGG - Intergenic
947943383 2:234078038-234078060 CTGGAGGAAAAGCAGCAACAAGG - Intergenic
948742231 2:240055615-240055637 AAGCAGGAAGAGGAGGAAGAGGG + Intergenic
1169317438 20:4604377-4604399 TAGCTGGAATTGCAGGCACATGG + Intergenic
1169391820 20:5196950-5196972 CAGGAGGAATACCAGGGCCACGG + Exonic
1170930517 20:20766219-20766241 CAGCAGGAAGAGCATGAAAATGG - Intergenic
1172956983 20:38767916-38767938 CAGAAGGACTAGCATGAGCAAGG + Intronic
1174337096 20:49870456-49870478 CAGCAGGAACTGCAGGAGCCAGG + Intronic
1174893868 20:54428222-54428244 TAGCAGTAATAGTAGGAGCAAGG + Intergenic
1175211183 20:57356976-57356998 CAGCAGCAATGGCAGGAGAAGGG - Intronic
1176261189 20:64181622-64181644 CAGCGGTTAGAGCAGGAACAAGG - Intronic
1176715628 21:10346918-10346940 CAGAAGAAACAGCAGGTACAAGG - Intergenic
1176818108 21:13626731-13626753 CAGCAGCAAGAGCAGGAGCGAGG - Intronic
1179112440 21:38458993-38459015 TAGGAGGAATAGCAGGAATATGG - Intronic
1179132968 21:38655359-38655381 AAGCAGGAATTTCAGAAACACGG - Intronic
1179907812 21:44433340-44433362 CAGCACGAACAGCAGTTACAGGG + Intronic
1180602719 22:17033035-17033057 CAGAAGAAACAGCAGGTACAAGG + Intergenic
1180898823 22:19356550-19356572 CAGCAGCCACATCAGGAACATGG + Intronic
1181257862 22:21575734-21575756 CAGGAGGAATGGCTTGAACATGG - Intronic
1181374653 22:22447334-22447356 CAGCAGGAACAGCAGAAAAAAGG + Intergenic
1181787455 22:25237475-25237497 CAGGAGGAAGAGCAGGGAAAGGG - Intergenic
1182431165 22:30299647-30299669 CAGCAGCAAGAGCAGAAACAGGG + Intronic
1182452061 22:30427513-30427535 CTGGAGCAATAGCAGGGACAAGG + Intronic
1184209743 22:43028499-43028521 CAGCTGGTAGAGCTGGAACATGG - Intergenic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
1184842880 22:47062970-47062992 CAGCAGCGAGCGCAGGAACATGG + Intronic
949328865 3:2898926-2898948 CAGCAGGAAGATAAAGAACAAGG + Intronic
950020896 3:9787055-9787077 CAGCATGAACAGCCGGAAGATGG - Exonic
950335077 3:12187119-12187141 CAGCAGGACAAGGAGGAACCAGG - Intronic
950408231 3:12817613-12817635 CAGCAGGAAGGGCAGGAAGTCGG - Exonic
951162546 3:19442317-19442339 CATCAGGAGTAGAAGAAACATGG - Intronic
951169904 3:19529046-19529068 CAGAAGGAATAGCATGCACCAGG + Intronic
951709750 3:25576086-25576108 CAAAAGCAATAGCATGAACACGG + Intronic
952192732 3:31041367-31041389 CAGCAGCAATAGCAGCAGCTGGG + Intergenic
952399118 3:32947665-32947687 CACCAGGAGTAACAGGGACAAGG - Intergenic
953439796 3:42907447-42907469 CAGCAGGGATGGCAGGAATGGGG + Intronic
955535478 3:59918925-59918947 CTGCAGGAAAAGCAGGAAGTAGG + Intronic
956173210 3:66449475-66449497 CTAATGGAATAGCAGGAACAAGG + Intronic
957150282 3:76477771-76477793 CATAAGGAACAGCAGGAAGAGGG - Intronic
957246970 3:77727930-77727952 CAGCAGCAATAGCAGTATCCTGG - Intergenic
957275382 3:78084390-78084412 CATCATGAATAGGAGGAAGATGG + Intergenic
958542511 3:95497295-95497317 CAGCATGCAGAGCAGGAATATGG + Intergenic
958743486 3:98104827-98104849 CACCAGGAACACCAGGAACAAGG - Intergenic
960670116 3:120147577-120147599 GAACAGGAAGAGCAGGAATAGGG + Intergenic
962429715 3:135307906-135307928 AAGAAGGAAAAGGAGGAACAGGG - Intergenic
964623669 3:158739029-158739051 GAGCAGCATTAGCAGGAAGAGGG - Intronic
964728718 3:159842664-159842686 CAGAAGGAATAGCAGGTGCAGGG - Intronic
964816836 3:160726895-160726917 CAGAGGGAATAGCAGGTGCAAGG - Intergenic
964893069 3:161559671-161559693 GAGCAGGAATAGGAAGAACAAGG - Intergenic
966807878 3:183820427-183820449 AAGCAGGAATAGCAAGAGCTTGG - Intronic
967777576 3:193400201-193400223 AAGCAGTAATTGAAGGAACAGGG - Intergenic
968451614 4:678660-678682 CAGCAGGAAGACCAAGAAGAAGG + Exonic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969325242 4:6440383-6440405 GAGCAGGAAAACCAGAAACAGGG + Intronic
969387784 4:6867345-6867367 CAGAAGGAACAGCAGAAGCAAGG + Intronic
971231757 4:24805870-24805892 CAGCAGGAAGAGCAGGAAGATGG + Intergenic
972871538 4:43306000-43306022 CAGCAGCATTAGCAGCAACTGGG - Intergenic
973819917 4:54653758-54653780 CATAAGGAATAGGAAGAACAAGG - Intergenic
974025910 4:56733022-56733044 CAGGAGGAATGACAGGATCATGG - Intergenic
974336116 4:60546984-60547006 AAGAAGGAATAGCAGGTGCAAGG - Intergenic
974479879 4:62429525-62429547 CAGCAGCATTAGTAGGGACAGGG + Intergenic
975059447 4:69978935-69978957 CAATAGGAATAGCAGGGGCAGGG + Intergenic
975989293 4:80240522-80240544 CAGGAGGAAAAGCAGGGAAATGG - Intergenic
976441840 4:85084980-85085002 CAGCAGGAACAGCAGCAGCTGGG - Intergenic
978421873 4:108541893-108541915 CAGGAAGCATAGCAGCAACATGG - Intergenic
982280491 4:153679649-153679671 GGGCAGGATCAGCAGGAACAGGG - Intergenic
983478691 4:168246460-168246482 CAGCATGAGTCGCAGGACCAGGG + Exonic
983490565 4:168384654-168384676 CAGCATGAGTCGCAGGACCAGGG + Exonic
984601142 4:181728360-181728382 CCGCAGGCAGAGCAGCAACATGG + Intergenic
985103726 4:186482388-186482410 CAGCAGGGATTCCAGAAACAAGG + Intronic
985447547 4:190033570-190033592 CAGCATGAACATCAGAAACATGG + Intergenic
985748754 5:1662382-1662404 CAGCAGGACTGGCAGCACCACGG - Intergenic
985924415 5:3004696-3004718 CTGCAGGAAAAGCGGGAAGAGGG + Intergenic
986274394 5:6260854-6260876 TTGCAGGAAGAGGAGGAACAGGG - Intergenic
986994895 5:13596053-13596075 GAGCACGAAAAACAGGAACATGG - Intergenic
990359568 5:55005170-55005192 CACCAGTAATATCAGGAACTAGG - Intronic
990782849 5:59385779-59385801 CAGGAAGAAGAGTAGGAACAGGG - Intronic
990829955 5:59944841-59944863 AAGGAGGAAGAGCAGGAAGAGGG - Intronic
992126689 5:73649744-73649766 CAGGAGGAATAGCAGGGTAATGG + Intronic
992658701 5:78936253-78936275 TAGCTGGAATTGCAGGCACAAGG + Intronic
992968170 5:82025313-82025335 CAGAAGCAATATCTGGAACAAGG - Intronic
993656799 5:90587648-90587670 CAGGAGGAATAGCTTGAACCTGG - Intronic
994080791 5:95707211-95707233 AAGGAGGAATATTAGGAACAAGG + Intergenic
996692257 5:126352763-126352785 CAGCAGGTACAGCTGGCACATGG - Intergenic
997172451 5:131737139-131737161 AAGCAGGAATTGTAGGAAAAAGG - Intronic
997986525 5:138505592-138505614 CAGATGGAATAGCAGAAACTAGG - Intergenic
998044784 5:138977876-138977898 CAGCAGGAATAGCCGTTGCAAGG - Intronic
998216728 5:140243159-140243181 CAGCAGCAATGGCAGGAACACGG + Intronic
998363989 5:141617070-141617092 CAGCAGCAATAGCTGGAATTTGG + Intronic
998563284 5:143192331-143192353 CAGCAGCACCAGCAGGAACATGG + Intronic
999139398 5:149347918-149347940 CAGCAGAAATAGCCAGAACTGGG - Intronic
999172833 5:149609767-149609789 CAGCACGAATGGCATGAAAAAGG - Intronic
999642314 5:153683929-153683951 CAGCAGCAATAGCAGAAAGCAGG + Intronic
1000713994 5:164617595-164617617 CAGGAGAAATAGCAGGAAAAGGG + Intergenic
1000877648 5:166660756-166660778 CAGCATGAATACCAGGAACAGGG + Intergenic
1002424821 5:179168711-179168733 CAGAATGAATGGCAGGGACAAGG + Intronic
1002809403 6:612728-612750 CAGCAGCAATAAAAGGAACAGGG + Intronic
1002843682 6:927125-927147 CAGCAGGCAGTGCAGGACCATGG + Intergenic
1003221319 6:4163446-4163468 CAGCAGGAAAAGAATGAACTTGG - Intergenic
1004638613 6:17492394-17492416 CAGAGGGTCTAGCAGGAACATGG + Intronic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1006055119 6:31378472-31378494 CTGTAGGACCAGCAGGAACACGG + Intergenic
1006059981 6:31412362-31412384 CAGCAGCAACAGCAGAAACATGG - Exonic
1006063343 6:31442146-31442168 CAGGAGCAGTGGCAGGAACAAGG - Intergenic
1006412601 6:33883608-33883630 CAGCAGGTATTGCAAGAAAATGG + Intergenic
1007189104 6:39998354-39998376 CAGCAGTCATAGCAGGAATAAGG - Intergenic
1007471134 6:42091213-42091235 CAGCAGGAAGACCAGGCAGAAGG + Intergenic
1007685765 6:43666486-43666508 GAGCAGGAGTCCCAGGAACAGGG - Exonic
1009675538 6:66814952-66814974 CAGGAAGAATATCAGGCACAGGG - Intergenic
1009701311 6:67185501-67185523 CAGCAGAGAGAGCAGGAATAGGG - Intergenic
1010387887 6:75303339-75303361 CAGCTTGTAGAGCAGGAACATGG + Intronic
1010793356 6:80090649-80090671 CAGCATGAGCAGCAGGAAAATGG + Intergenic
1012790589 6:103689208-103689230 CAGAAGAAATAGCACAAACAGGG + Intergenic
1014770682 6:125454716-125454738 CAGCAGGAATAAGAGAAACTTGG - Intergenic
1015138398 6:129900840-129900862 CTGCAGACATTGCAGGAACATGG + Intergenic
1016799774 6:148156821-148156843 CAGCTGGAAAAGAAGGCACAAGG + Intergenic
1017596324 6:156032447-156032469 TAACAGCAATAGCAGAAACAGGG - Intergenic
1018031011 6:159841750-159841772 CAGGAGACATAGTAGGAACAGGG - Intergenic
1019058946 6:169242165-169242187 CACCAGGAACAGCAGGGACAGGG + Intronic
1019756479 7:2774450-2774472 CAGAAGGAACAGCAAGCACAAGG + Intronic
1020015635 7:4829792-4829814 CAGAAGGCAAAGGAGGAACAAGG - Intronic
1020224442 7:6269070-6269092 CAGGAGGAATGGCAGGAAGAAGG - Intronic
1020582967 7:10029174-10029196 TAGCAGGGATAGCAGGCACCTGG - Intergenic
1020677904 7:11202313-11202335 AAGGAGGAATATCAGGAACCAGG - Intergenic
1021906596 7:25339835-25339857 CAGCAAAAATACTAGGAACATGG - Intergenic
1022630105 7:32076758-32076780 CTTCAGGCATAGCAGGATCAGGG - Intronic
1023473816 7:40554947-40554969 CAGAAGGAATAGCAGTTTCATGG - Intronic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1026255947 7:68711501-68711523 TAGCTGGTAAAGCAGGAACAGGG - Intergenic
1026510871 7:71026524-71026546 CAGCAGGTAGAGGAAGAACATGG - Intergenic
1026555905 7:71408454-71408476 TAGCAGTGGTAGCAGGAACAGGG + Intronic
1027900017 7:84100967-84100989 AAGTAGAAATAGCAGGGACATGG - Intronic
1028424043 7:90666166-90666188 CAATAAGAATAGCAGGTACAGGG - Intronic
1028915358 7:96252961-96252983 TAGCTGGAATAACAGGAGCATGG - Intronic
1029321903 7:99769688-99769710 CAGCAGGAATATCAGCTCCATGG + Intronic
1029450720 7:100640712-100640734 CCCCAGGAACTGCAGGAACATGG + Exonic
1029633558 7:101768615-101768637 CAGAGGGAACAGCAGGTACAAGG - Intergenic
1030409710 7:109160642-109160664 CAGCAGGAACAGGATGCACAAGG - Intergenic
1030713587 7:112783301-112783323 CACTAGTACTAGCAGGAACAAGG - Intronic
1031975287 7:128089783-128089805 CAGCAGGAACAGCAGGATGGTGG - Intronic
1032197278 7:129796615-129796637 CAGCAGGAACAGCCGGTCCATGG + Intergenic
1032429117 7:131846550-131846572 GAGTAGGAACAGCAGGAAGATGG + Intergenic
1033031085 7:137827458-137827480 CAGCAGGAATTGCATGAGAAAGG - Intronic
1033672220 7:143504191-143504213 CAGCAGGAAAAGAAGAAACCAGG - Intergenic
1033716089 7:144004073-144004095 CACAAGGAATATCAGAAACATGG - Exonic
1034072116 7:148196378-148196400 CAGCAGGATTCGGAGGAACTGGG + Intronic
1034701655 7:153101569-153101591 CAGAAGGCAAAGCGGGAACAGGG - Intergenic
1035318481 7:158013235-158013257 AAGCAGGAAAAGAAGGCACAGGG - Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1038005595 8:23427253-23427275 CAGCAAGAACAGCTGGCACAAGG + Intronic
1038037035 8:23695147-23695169 CAGCAGGAAGAGAAGGAAAGTGG + Intergenic
1038046430 8:23769106-23769128 CAGGGGGAATGGCAGGTACAGGG - Intergenic
1039165147 8:34670644-34670666 CAGAAGGAATGGCAAGTACAAGG - Intergenic
1039201940 8:35104791-35104813 CAGCAAGAAGAGCAGTGACAGGG + Intergenic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1041153734 8:54962541-54962563 CAGCAGAAATAGCAGAAGCAAGG + Intergenic
1041568605 8:59309849-59309871 CAGCAGGCAGATCAGAAACAGGG + Intergenic
1041713675 8:60914717-60914739 CAGCAGGAAGAAGAGGAACTAGG + Intergenic
1042659566 8:71139516-71139538 CAGCAGGAGTAGCAAAAAAATGG + Intergenic
1042699513 8:71596902-71596924 CTTCAGGAAGAGCAGGAACCAGG + Intergenic
1043051513 8:75391784-75391806 CAGCAGCAATAGCAGATTCATGG - Intergenic
1043180751 8:77083689-77083711 CAGCAGGACCAGCAGGAAGTGGG - Intergenic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045808626 8:106195156-106195178 CAGATTTAATAGCAGGAACAAGG - Intergenic
1047232739 8:123011131-123011153 CAGCAGCAAGAGCAGAAACTTGG - Intergenic
1047647157 8:126881215-126881237 CAGCTGGAAGAGCAGAAATAAGG - Intergenic
1048418108 8:134249651-134249673 CAGCAGGGGCAGCAGCAACAGGG - Intergenic
1048877537 8:138848859-138848881 CAGCAGGAGCAGTAGAAACAAGG + Intronic
1049032614 8:140048789-140048811 CCGCATGAATAGCAGGCCCAGGG + Intronic
1049325491 8:142019443-142019465 CAGCAGGAGGATCAGGAGCACGG - Intergenic
1049453398 8:142674976-142674998 CAGAGGGAATAGCAGGCACGGGG - Intronic
1049850686 8:144828539-144828561 CAGCAGGAATAGCATGTGAAAGG - Intronic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050604689 9:7288407-7288429 CAGCAGAAATAGCAGTAATGTGG - Intergenic
1051374746 9:16391790-16391812 GAGGAGGAACAGGAGGAACAGGG - Intergenic
1052666600 9:31502789-31502811 CAGCATCAACAGCAGGAGCAAGG + Intergenic
1054796911 9:69310925-69310947 CAGCTGGAACAGCTGGAACCAGG + Intergenic
1055607717 9:77988305-77988327 CAGAAAGAATACCAGGAAAACGG + Intronic
1056045137 9:82706791-82706813 CAGCAGGAATTACAGAAACGTGG - Intergenic
1056068074 9:82957755-82957777 CAGAAACAATTGCAGGAACATGG + Intergenic
1056556920 9:87697281-87697303 CAGCAGCAGTGGCAGGAGCAGGG - Intronic
1057158881 9:92870752-92870774 CAGCATGAAGAGCAGAAACAAGG + Intronic
1057702095 9:97370745-97370767 CAGCATGATTAGGATGAACAAGG + Exonic
1059085688 9:111300216-111300238 TAGAAGGAATAGCAAGAACTTGG + Intergenic
1059206522 9:112472277-112472299 AAGCAGCACTAGCAGGAACAAGG - Exonic
1059976401 9:119722567-119722589 CAGCAGGTATAGCAGGAAGCAGG + Intergenic
1060849974 9:126866483-126866505 CAGAAGGAAAAGCAGGAACAGGG - Intronic
1061860874 9:133468246-133468268 CAGCAAGGATAGCAAAAACATGG + Intronic
1061864613 9:133485842-133485864 CAGGAGGAACAGCAGGACAAGGG - Intergenic
1062303930 9:135891244-135891266 CAGCATGAGCAGCAGAAACAGGG + Intronic
1062318644 9:135979910-135979932 CAGCAGGCAATGCAGGACCACGG + Intergenic
1203529251 Un_GL000213v1:122773-122795 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1186404207 X:9287466-9287488 CAGTAGGAACAGCAAGAGCAAGG - Intergenic
1186996456 X:15128674-15128696 GAGGAGGAATAGCAGAAAGAGGG + Intergenic
1187537394 X:20155262-20155284 CAGCAGGAACAGCAGCATTATGG + Exonic
1188289869 X:28374010-28374032 CAGCAGCTGTAGCAGGAAAATGG - Intergenic
1188448576 X:30284360-30284382 CAGCAGGAAGAGGAAAAACATGG + Intergenic
1188635208 X:32421408-32421430 CACCTTGAACAGCAGGAACATGG + Intronic
1188655510 X:32689981-32690003 AATCAGGAACAGGAGGAACAAGG + Intronic
1189252391 X:39611422-39611444 CAGGAAAAATTGCAGGAACACGG - Intergenic
1190735642 X:53254471-53254493 TAGCAGGAGTAGCCAGAACACGG + Intronic
1190745197 X:53318403-53318425 CTGCACGGATAGCAGAAACATGG + Intronic
1191915493 X:66197561-66197583 GAGCAGCAGTAGCAGCAACATGG - Intronic
1193818622 X:86133989-86134011 CAGGAGGAAAAGCAGTAAAATGG + Intergenic
1196382485 X:115106552-115106574 AAGCAAGAATAGCAAGAAAATGG + Intergenic
1196856935 X:119993120-119993142 CAGCAGGACTACCAGGCACTTGG - Intergenic
1198472447 X:136960182-136960204 GAGGAGGAATAATAGGAACAAGG - Intergenic
1198610674 X:138396244-138396266 CAGAAGGCAAAGCAGGAGCAGGG - Intergenic
1199774868 X:151001950-151001972 AAGCAGGAAGAGCAAGAATATGG + Intergenic
1199785868 X:151104344-151104366 CAGCAGGAAGAGCAGGTTGAGGG - Intergenic
1199843058 X:151670388-151670410 TAGCTGGAATAGAAGGAATAAGG - Intronic
1201381699 Y:13386866-13386888 CAGCTGGGATTGCAGGCACATGG - Intronic