ID: 903372331

View in Genome Browser
Species Human (GRCh38)
Location 1:22844736-22844758
Sequence TGGGGGCTTCCTGGGGGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 598}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903372331_903372343 0 Left 903372331 1:22844736-22844758 CCGGATCCCCCAGGAAGCCCCCA 0: 1
1: 0
2: 3
3: 45
4: 598
Right 903372343 1:22844759-22844781 AGAAGGAAGCCTATAGCCTGGGG 0: 1
1: 0
2: 1
3: 17
4: 196
903372331_903372345 13 Left 903372331 1:22844736-22844758 CCGGATCCCCCAGGAAGCCCCCA 0: 1
1: 0
2: 3
3: 45
4: 598
Right 903372345 1:22844772-22844794 TAGCCTGGGGCCAGCATCCTTGG 0: 1
1: 0
2: 1
3: 21
4: 223
903372331_903372346 14 Left 903372331 1:22844736-22844758 CCGGATCCCCCAGGAAGCCCCCA 0: 1
1: 0
2: 3
3: 45
4: 598
Right 903372346 1:22844773-22844795 AGCCTGGGGCCAGCATCCTTGGG 0: 1
1: 0
2: 2
3: 27
4: 257
903372331_903372342 -1 Left 903372331 1:22844736-22844758 CCGGATCCCCCAGGAAGCCCCCA 0: 1
1: 0
2: 3
3: 45
4: 598
Right 903372342 1:22844758-22844780 AAGAAGGAAGCCTATAGCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 201
903372331_903372341 -2 Left 903372331 1:22844736-22844758 CCGGATCCCCCAGGAAGCCCCCA 0: 1
1: 0
2: 3
3: 45
4: 598
Right 903372341 1:22844757-22844779 CAAGAAGGAAGCCTATAGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903372331 Original CRISPR TGGGGGCTTCCTGGGGGATC CGG (reversed) Intronic
900404336 1:2485891-2485913 TGGGGGCATCCCGGGAGCTCAGG - Intronic
900418507 1:2545818-2545840 CGGGGGCTTCCTGGGGGAGGTGG + Intergenic
900496750 1:2979162-2979184 CAGGAGCTTCCTGGGGGGTCCGG + Intergenic
901180146 1:7336197-7336219 TCAGGGCTTCATGGGGGACCAGG - Intronic
901641012 1:10693124-10693146 TGGGGGCCTCCTGTGGGACAAGG - Intronic
901648528 1:10729273-10729295 GGGGGGCTTCCTGGGGGAGGAGG + Intronic
902050967 1:13563364-13563386 TGTGGGCTTCCAAGGTGATCAGG - Intergenic
902209234 1:14892763-14892785 TGGGGGCCTCCTGCAGGCTCCGG + Intronic
902251277 1:15155273-15155295 TGGGGGCTCCCTGAGGCTTCTGG - Intronic
902374368 1:16023387-16023409 TGGGAGGTTCCTGGGGGACAGGG - Intronic
902379323 1:16045265-16045287 TGGGAGGTTCCTGGGGGACAGGG - Intronic
902571333 1:17348820-17348842 TGGGGTCTTCCTGGGAAAGCAGG - Intronic
902780235 1:18700251-18700273 GGGGGGCTTCCTGGAGGAGGTGG + Intronic
902795803 1:18799783-18799805 CAGGGTCTTCCTGGGGGATCAGG + Intergenic
903018470 1:20377191-20377213 TGGGGGCACCCTGGGGGAGAGGG + Intergenic
903071854 1:20730638-20730660 TGGGGGGCTCCCGGGGGACCAGG + Intronic
903284042 1:22266219-22266241 GGGGGGCCTCCTGGGGGCTTTGG + Intergenic
903372331 1:22844736-22844758 TGGGGGCTTCCTGGGGGATCCGG - Intronic
903793552 1:25911046-25911068 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
904012153 1:27395897-27395919 GGGGGGCCTGTTGGGGGATCTGG + Intergenic
904239977 1:29137755-29137777 CGGGGGCTTTCTGGGGGTGCTGG - Intergenic
905093417 1:35448219-35448241 TGGGGTCCTCCTGGGGGTGCTGG - Exonic
907521308 1:55025084-55025106 TGGGGGCTTCCGAGGCGATCGGG - Intergenic
908461667 1:64353194-64353216 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
908591906 1:65645102-65645124 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
908852455 1:68388749-68388771 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
909061353 1:70882393-70882415 TGGGTGCTTCCTGGGACAGCAGG + Intronic
909729475 1:78874771-78874793 AGGGGGCTTCCGAGGCGATCAGG - Intergenic
909776641 1:79491793-79491815 AGGGGGCTTCCGAGGTGATCGGG + Intergenic
910149573 1:84126065-84126087 TGGAAGCTTCCTGGGGGGTGGGG + Intronic
910163520 1:84298899-84298921 TGGGGGCTCCCCGGGGAAGCCGG - Intronic
911326122 1:96471604-96471626 TGGGGACCTTCTGGGGTATCAGG - Intergenic
913333614 1:117687345-117687367 AGGAGGCTTCCTGGGGGAGAAGG + Intergenic
914492117 1:148158810-148158832 AGGGGGCTGCCTGGGGGAGTGGG - Intergenic
915474778 1:156147132-156147154 TGGGGGCTTCCAGGGGAGTAGGG + Intergenic
916166958 1:161973130-161973152 TGGGGCCTTCCTGTGGGAGGTGG + Intergenic
919419743 1:197355486-197355508 TGGGGGATTGCGGGGGGCTCAGG + Intronic
919859304 1:201728703-201728725 TGGGAGGTTCAGGGGGGATCGGG - Intronic
919939701 1:202277838-202277860 AGGAGGCTTCCTGGGGGAGGTGG + Intronic
920283271 1:204859985-204860007 TGTGAGCATCCTTGGGGATCAGG + Intronic
920697396 1:208191796-208191818 TGGGGGCTTCCTAGAGGAGGTGG + Intronic
920829450 1:209451415-209451437 TGGGGGCTTCCGAGGCGATCCGG - Intergenic
921212469 1:212911989-212912011 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
921509307 1:216010480-216010502 AGGGGGCTTCCAAGGCGATCGGG - Intronic
921520182 1:216148027-216148049 AGGGGGCTTCCGAGGCGATCGGG - Intronic
922154018 1:223027633-223027655 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
923244805 1:232120662-232120684 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
923408580 1:233686662-233686684 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
924582864 1:245336421-245336443 TGGCGGCTGCGTGGTGGATCTGG + Intronic
1063509549 10:6632826-6632848 AGGGGGCTTCCGAGGCGATCCGG + Intergenic
1063527633 10:6800323-6800345 AGGGGGCTTCCGAGGCGATCCGG + Intergenic
1064022923 10:11823743-11823765 TGGGGCTATCCTGGGGGCTCAGG + Intronic
1065443072 10:25771981-25772003 AGGGGGCTTCCGAGGTGATCGGG + Intergenic
1066702300 10:38143086-38143108 TGTGGGCTGCCAGGGGGACCTGG - Intergenic
1067162898 10:43842347-43842369 CGGGGGCTCCCTGGGGGGTCAGG + Intergenic
1067479157 10:46584236-46584258 TGGGGCCTTCCTGGGGGTGGTGG - Intronic
1067615582 10:47757565-47757587 TGGGGCCTTCCTGGGGGTGGTGG + Intergenic
1067791926 10:49294982-49295004 GGTCGGCTTCCTGGTGGATCTGG - Intergenic
1068179610 10:53502263-53502285 AGGGGGCTTCCGAGGTGATCGGG + Intergenic
1068592296 10:58864245-58864267 TGGGGGCTTCTGAGGCGATCGGG + Intergenic
1070474973 10:76821053-76821075 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1070510993 10:77160384-77160406 TAGGGACTTGCTGGGGGAGCTGG - Intronic
1070835933 10:79446700-79446722 CCGGGGCTTCCTGGGGCGTCAGG - Intergenic
1071508643 10:86247767-86247789 TGGGTGCTCCCTGGGGTCTCAGG - Intronic
1071961158 10:90809905-90809927 AGGGGGCTTCCGAGGTGATCAGG - Intronic
1072580310 10:96734696-96734718 AGGGGGCTTCCGAGGTGATCGGG - Intergenic
1072738748 10:97896885-97896907 TGAGGGGCACCTGGGGGATCTGG - Intronic
1073036844 10:100569980-100570002 TGGGGGCAACCTGGGGGGCCAGG + Intergenic
1073394666 10:103208049-103208071 AGGGGGCTTCCAAGGTGATCAGG - Intergenic
1074740829 10:116483133-116483155 AGGGGGCTTCCAAGGCGATCGGG - Intergenic
1076131330 10:128016040-128016062 TGTGGGCTTCCTGGGGTTGCAGG + Intronic
1076668278 10:132105030-132105052 TGGGGGTTTCCACAGGGATCTGG - Intronic
1076795006 10:132794132-132794154 TGGGGGCTTCCAGGGGGGTGAGG + Intergenic
1077023749 11:430809-430831 TGGGGGCGTCCGCGGGTATCTGG + Intronic
1077023758 11:430829-430851 TGGGGGCTTCCGCGGGGGTGTGG + Intronic
1077023812 11:430969-430991 TGGGGGCTCCCGCGGGTATCTGG + Intronic
1077023829 11:431009-431031 TGGGGGCTCCCGCGGGTATCTGG + Intronic
1077023845 11:431049-431071 TGGGGGCTCCCGCGGGTATCTGG + Intronic
1077023855 11:431069-431091 TGGGGGCTTCCGCGGGGGTGTGG + Intronic
1077023862 11:431089-431111 TGGGGGCTCCCGTGGGTATCTGG + Intronic
1077023878 11:431129-431151 TGGGGGCTCCCGCGGGTATCTGG + Intronic
1077023888 11:431149-431171 TGGGGGCTTCCGCGGGGGTGTGG + Intronic
1077023895 11:431169-431191 TGGGGGCGTCCGCGGGTATCTGG + Intronic
1077023910 11:431209-431231 TGGGGGCTCCCGTGGGTATCTGG + Intronic
1077023927 11:431249-431271 TGGGGGCTCCCGTGGGTATCTGG + Intronic
1077023937 11:431269-431291 TGGGGGCTTCCGCGGGGGTGTGG + Intronic
1077023944 11:431289-431311 TGGGGGCGTCCGCGGGTATCTGG + Intronic
1077023960 11:431330-431352 TGGGGGCTCCCGCGGGTATCTGG + Intronic
1077023976 11:431370-431392 TGGGGGCTCCCGCGGGTATCTGG + Intronic
1077023991 11:431410-431432 TGGGGGCGTCCGCGGGTATCTGG + Intronic
1077024006 11:431450-431472 TGGGGGCTCCCGCGGGTATCTGG + Intronic
1077024021 11:431490-431512 TGGGGGCTCCCGCGGGTATCTGG + Intronic
1077024031 11:431510-431532 TGGGGGCTTCCGCGGGGGTGTGG + Intronic
1077024038 11:431530-431552 TGGGGGCTCCCGTGGGTATCTGG + Intronic
1077024054 11:431570-431592 TGGGGGCTCCCGCGGGTATCTGG + Intronic
1077024064 11:431590-431612 TGGGGGCTTCCGCGGGGGTGTGG + Intronic
1077024071 11:431610-431632 TGGGGGCGTCCGCGGGTATCTGG + Intronic
1077098945 11:812691-812713 TGGGGTCTTCATGGGGGGACTGG + Intronic
1077330946 11:1983572-1983594 GAGGGGCTGCCTGGGGTATCTGG + Intronic
1077407399 11:2388783-2388805 TGGGGGCTTCCTGGAGGAGGAGG - Intronic
1077425305 11:2473301-2473323 TGGGGGCTTGCTGGGGACTCAGG + Intronic
1077531960 11:3101565-3101587 TGGGCGCTCCCTGGGGCCTCAGG - Intronic
1077551039 11:3200485-3200507 GGGGGGCTTCCTGGAGGAGGTGG - Intergenic
1077551055 11:3200525-3200547 GGGGGGCTTCCTGGAGGAGGTGG - Intergenic
1077551065 11:3200558-3200580 AGGGGGCTTCCTGGAGGAGGTGG - Intergenic
1077551086 11:3200623-3200645 GGGGGGCTTCCTGGAGGAGTTGG - Intergenic
1078046081 11:7915391-7915413 TGGGGGCTTCTGAGGTGATCAGG + Intergenic
1078357294 11:10642032-10642054 TGAGGGCTTCCTGGAGGAAGAGG - Intronic
1078610202 11:12813184-12813206 TGGGGGCTCCCTGGGAGCCCTGG + Intronic
1079447510 11:20570272-20570294 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1079707156 11:23635209-23635231 TGGGGTCCTGCTGGGGGATGGGG + Intergenic
1081159746 11:39736885-39736907 AGGGGGCTTCCGAGGTGATCAGG - Intergenic
1083619853 11:64043477-64043499 TGGGTGACTCCTGGGGGAGCTGG + Intronic
1083815943 11:65132496-65132518 TGGGAACTTCCTGGGGGAGGGGG + Intronic
1084459741 11:69289928-69289950 TGGGCTCCTTCTGGGGGATCTGG + Intergenic
1084772049 11:71349645-71349667 AGGGGCCTTGCTGGGGGAGCAGG + Intergenic
1084913746 11:72412030-72412052 TGGAGGCTGCCTGGGGATTCTGG - Intronic
1087314725 11:96590407-96590429 AGGGGGCTTCCAAGGTGATCGGG - Intergenic
1089631199 11:119785462-119785484 TGGGTGTGTCCTGGGGGAGCAGG + Intergenic
1089680740 11:120117631-120117653 TGGGGGCATCCTGAGGGGGCAGG - Intronic
1089935469 11:122359757-122359779 CAGGGGTTTCCTGGGGGCTCTGG - Intergenic
1090238033 11:125164098-125164120 TGTGGGCTTCCCGGGGTGTCTGG - Intergenic
1090385701 11:126356452-126356474 TGGGTGTTTCCTCGGGGACCTGG + Intronic
1090495322 11:127206109-127206131 TGGGTGTTTCCTGGGGCAACAGG - Intergenic
1090850547 11:130567592-130567614 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1091183725 11:133629270-133629292 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1091237347 11:134031127-134031149 TGGGAGCTCCCTGGGGGCTCAGG + Intergenic
1091267584 11:134282741-134282763 GCAGGGCTTCCTGGGGAATCTGG + Intronic
1202813926 11_KI270721v1_random:38751-38773 GAGGGGCTGCCTGGGGTATCTGG + Intergenic
1092129054 12:6095842-6095864 TGGGGGCCTCCTGGGGAGTGGGG - Intronic
1092626702 12:10336157-10336179 AGGGGGCTTCCGAGGCGATCCGG + Intergenic
1093321939 12:17723503-17723525 AGGGGGCTTCCGAGGTGATCGGG + Intergenic
1094400727 12:30058461-30058483 AGGGGGCTTCCAAGGTGATCGGG - Intergenic
1096239842 12:49953945-49953967 CATGGGCATCCTGGGGGATCAGG + Intronic
1096839941 12:54374005-54374027 GGGGTGCTGCCTGGGGGAGCTGG + Exonic
1097224112 12:57467028-57467050 TGGGGTCATCTTGGGGGAACGGG - Intronic
1097489012 12:60240891-60240913 TGGGGTCTTCCTGAGGGTGCAGG - Intergenic
1097862694 12:64533891-64533913 TTGGGGCTTCCTGCGGCTTCGGG + Intergenic
1098171724 12:67753668-67753690 TGCGGGCTTCCTGTGGGAAAAGG - Intergenic
1098173593 12:67769877-67769899 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1098402299 12:70087884-70087906 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1098597957 12:72295124-72295146 TGGGGGGTGGCTGGGGGATGGGG + Intronic
1099188765 12:79542343-79542365 AGGGGGCTTCCGAGGTGATCCGG - Intergenic
1099292052 12:80786310-80786332 AGGGGGCTTCCAAGGCGATCGGG + Intergenic
1099872836 12:88370158-88370180 AGGGGGCTTCCAAGGCGATCGGG - Intergenic
1100561409 12:95751660-95751682 AGGGGGCTTCCGAGGTGATCGGG - Intronic
1100940347 12:99717671-99717693 AGGGGGCTTCCAAGGCGATCGGG - Intronic
1101278350 12:103225908-103225930 AAGGGGCTTCCTAGGCGATCGGG + Intergenic
1101331218 12:103759285-103759307 TCTGGGCTTCTTGGGGGAACGGG + Intronic
1102247711 12:111365749-111365771 TCGGGGCCTGTTGGGGGATCGGG + Intronic
1102520992 12:113477316-113477338 AGGGGGCTTCCTGTGGGACCCGG + Intergenic
1102700484 12:114834885-114834907 TGGGGTCTCCATGGGGGATCAGG + Intergenic
1103215101 12:119195678-119195700 TGGGGGGTGCCTGGGAGATGGGG + Intronic
1103727270 12:123004345-123004367 TGGGGCCTTCCTGGGCGAGGTGG - Intronic
1103886941 12:124209357-124209379 TGGGAGCTGCCTGGGAGCTCTGG + Intronic
1103906149 12:124328121-124328143 TGGGGGCTGGCTGGGGGCTGGGG + Intronic
1103931807 12:124454546-124454568 CGGGGGCCTCCTGGGGGAAAGGG - Intronic
1104020893 12:124991557-124991579 GGGAGGCTTCGTGGGGGAACTGG + Intergenic
1104257656 12:127154277-127154299 AGGGGGCTTCCAAGGTGATCGGG - Intergenic
1104536250 12:129620809-129620831 TGGGGCCCTCTTGGGGGATGAGG + Intronic
1104724346 12:131066754-131066776 TGGGGGGATCGTGGGGCATCGGG + Intronic
1104848964 12:131862051-131862073 TGAGGGCTTCCTGGAGGAGGTGG + Intergenic
1105032259 12:132892192-132892214 AGGGGGCTTCCAGGGTGATCAGG - Intronic
1105071379 12:133236004-133236026 TGAGGGGTCCGTGGGGGATCTGG + Exonic
1107075630 13:36318926-36318948 AGGGGGCTTCCGAGGCGATCGGG - Intronic
1107129925 13:36884326-36884348 AGGAGGCTTTGTGGGGGATCTGG - Intronic
1107418373 13:40222394-40222416 GGGGGATTTCCTGGGTGATCTGG - Intergenic
1107555823 13:41516068-41516090 TGGGGACTTCCTCTGGGAGCAGG + Intergenic
1107829730 13:44363675-44363697 TGGGAGCTTCCTGGAGCACCAGG + Intergenic
1107879463 13:44820512-44820534 TGGGGCTTCCCTGGGGGAGCTGG + Intergenic
1108513044 13:51172351-51172373 AGGGGGCTTCCGAGGTGATCCGG - Intergenic
1108913370 13:55581473-55581495 AGGGGGCTTCCGAGGTGATCCGG + Intergenic
1108919500 13:55658202-55658224 AGGGGGCTTCCGAGGCGATCCGG + Intergenic
1108947483 13:56042795-56042817 AGGGGGCTTCCAAGGCGATCAGG - Intergenic
1108952899 13:56115646-56115668 AGGGGGCTTCCGAGGTGATCCGG + Intergenic
1109609533 13:64745101-64745123 TGGGGGCTTCCTGAGGAAGCAGG + Intergenic
1109709617 13:66144565-66144587 AGGGGGCTTCCGAGGTGATCGGG + Intergenic
1110282780 13:73714646-73714668 TGGAGGCATCCTGGAGGAACTGG + Intronic
1111125993 13:83911509-83911531 AGGGGGCTTCCCAGGCGATCGGG + Intergenic
1111362059 13:87189655-87189677 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1111605811 13:90538069-90538091 TGGGTGCTTCCTGGGAAAACAGG - Intergenic
1113969110 13:114175211-114175233 TGGGGTCTTTGTGGGGGATGGGG - Intergenic
1116179728 14:41518427-41518449 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1116347657 14:43815530-43815552 TAGGGTCTTCCTGGGGGCTGAGG + Intergenic
1116613559 14:47106665-47106687 AGGGGGCTTCCGAGGCGATCGGG - Intronic
1116799685 14:49429661-49429683 TGGGTGCTTCCTGGGGCAATAGG - Intergenic
1116952962 14:50895655-50895677 AGGGGGCTTCCGAGGCGATCGGG - Intronic
1117957869 14:61136650-61136672 AGGGGGCTTCCGAGGCGATCAGG + Intergenic
1118937211 14:70299030-70299052 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1119542718 14:75451249-75451271 TGGAGGCCTCCTGGGGGACTGGG + Intronic
1121193250 14:92047941-92047963 AGGGGGCTTCCAAGGCGATCAGG + Exonic
1121289462 14:92762352-92762374 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1121860423 14:97312662-97312684 TGAGAGCTTCCTGGGTGATGAGG + Intergenic
1122041046 14:98987679-98987701 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1122909595 14:104820897-104820919 TGGCGGCTTCCTGCAGGAACTGG + Intergenic
1123113205 14:105882484-105882506 TGATGGCTTCCTGGGGATTCTGG + Intergenic
1123119801 14:105911352-105911374 TGATGGCTTCCTGGGGATTCTGG + Intergenic
1123937350 15:25200421-25200443 GGGGGACTTCCAGGGGGAGCAGG - Intergenic
1125045824 15:35241254-35241276 AGGGGGCTTCCGAGGCGATCGGG - Intronic
1125131468 15:36288869-36288891 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1128552678 15:68608468-68608490 TGGGGGCTCCCTGAGGGAGAGGG - Intronic
1129787402 15:78318889-78318911 TGGGGGATCCCTGGGGGTGCAGG + Intergenic
1130076473 15:80694912-80694934 CGGGGGCTTCCAGGCGGCTCCGG - Intronic
1131072857 15:89476972-89476994 TCAGGGATTCCTGGGGGCTCAGG + Intronic
1131465320 15:92650367-92650389 TTGGTGCTTCCCGAGGGATCGGG - Intronic
1131882468 15:96875052-96875074 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1131979772 15:97983511-97983533 TGGTGGCTTCCACGGAGATCAGG - Intergenic
1132263060 15:100442771-100442793 AGGGGGCTTCCGAGGTGATCGGG - Intronic
1132338929 15:101065921-101065943 TGAGTGATTCCTGGTGGATCAGG - Exonic
1132340464 15:101075021-101075043 AGGGGGCTTCCGAGGTGATCGGG - Intronic
1132646508 16:1001686-1001708 TGGGGTCATCCTGGGTTATCTGG - Intergenic
1132674724 16:1116959-1116981 GGGGGGCATCCTGGGGGTTGAGG - Intergenic
1132679820 16:1135126-1135148 TCGGGGCAGCCTGGGGGATTGGG + Intergenic
1132880243 16:2158947-2158969 AGAGGGCTTCCTGGAGGATGAGG - Intronic
1132941554 16:2510971-2510993 TGGGGGCTTCCTGGAGGAGGTGG + Intronic
1133021239 16:2967848-2967870 TGGGGGCTTCCAGGGGCCCCAGG + Exonic
1133210808 16:4262499-4262521 GGAGGGCTTCCTGGAGGAGCCGG - Intronic
1133236765 16:4391035-4391057 TGGGGGCTTCCTGTGGTCTCTGG - Intronic
1133766718 16:8843320-8843342 TGGGGGCTTCCAAGGCGATTGGG + Intronic
1134342130 16:13355796-13355818 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1134791623 16:16994214-16994236 TGGGGGCTTGATGAAGGATCAGG + Intergenic
1135398248 16:22147466-22147488 TGGAGGGTTTCTGGGGCATCAGG + Intronic
1135492580 16:22922725-22922747 TGGGGGCTCCATGGGGGTGCAGG - Intergenic
1135940781 16:26819977-26819999 TGGGACCCTCCTTGGGGATCTGG - Intergenic
1137562204 16:49510168-49510190 TGTGGCCTTCCTAGGGGACCAGG + Intronic
1137724985 16:50650994-50651016 GGAGGGCTTCCTGGAGGAGCGGG - Intergenic
1138352680 16:56354255-56354277 GCGGGGCTTCCGGGTGGATCTGG + Intronic
1138387266 16:56644184-56644206 TGGGGCCTTCCCTGGGAATCTGG + Intronic
1138387942 16:56648899-56648921 TGGGGCCTTCCCTGGGAATCAGG + Intronic
1138589079 16:57989809-57989831 AGGGGGCTTCCTGGGGGTGGGGG + Intergenic
1138737369 16:59265998-59266020 GGGAGGCTTCCTGGGAGATGTGG - Intergenic
1138804998 16:60081313-60081335 TGGGGGCTTCCAAGGCAATCGGG - Intergenic
1139225866 16:65233060-65233082 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1139230550 16:65278481-65278503 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1141760773 16:86027097-86027119 TGGGGGCTTCGCGGGGGAGTGGG - Intergenic
1141954793 16:87363442-87363464 TAGGGGCCTCCTGGGTGACCTGG + Intronic
1142284053 16:89164488-89164510 CTGGGCCGTCCTGGGGGATCAGG - Intergenic
1142804870 17:2366159-2366181 TCGGGGCTGCCTGGGGGCTTTGG + Intronic
1142968138 17:3593631-3593653 TGGGGGCTTCATGGAGGAGGCGG - Intronic
1143024993 17:3936306-3936328 TGAGGGCTTCTCGGGGGCTCCGG + Exonic
1143116105 17:4582661-4582683 TGGGGGCTCACTGTGGGTTCTGG - Intergenic
1143739470 17:8941995-8942017 TGGGGGCTTCAGGGAGGCTCAGG + Intronic
1143899541 17:10163708-10163730 TGGGGGCTTGCTGGGAGAATGGG - Intronic
1144207374 17:12988590-12988612 TGAGGGCTGCCTGGGGGTTGGGG + Intronic
1144738955 17:17570618-17570640 TTGGGCCTTTCTGGGTGATCTGG - Intronic
1144971205 17:19110999-19111021 TGGGGGTTTTTTGGGGGCTCGGG + Intergenic
1144991507 17:19237162-19237184 TGGGGGTTTTTTGGGGGCTCGGG + Intronic
1146185194 17:30720070-30720092 TGAGGGCTTCCTGGAGGAGGTGG + Intergenic
1147604655 17:41767654-41767676 GGGAGGCTTCCTGGGGGAGGTGG - Intronic
1148718169 17:49730608-49730630 GGAGGGCTTCCTGGAGGAACAGG - Intronic
1148736958 17:49870277-49870299 TGGGGGCTGCCGAGGGGATCAGG + Intergenic
1148811904 17:50298374-50298396 TCCGGATTTCCTGGGGGATCTGG - Intergenic
1149319622 17:55470320-55470342 AGGGGGCTTCCAAGGCGATCAGG - Intergenic
1149430543 17:56593436-56593458 TGTCGGCTTCCCGGGGCATCTGG + Intergenic
1149555062 17:57567706-57567728 GGGGGTCTTCCTGGTGGATGGGG + Intronic
1151279572 17:73063027-73063049 TGGGGGCCTGCTGGGGGTTGGGG + Intronic
1152193005 17:78899791-78899813 TTGGGGCATCCTGGGGGAGTGGG - Intronic
1152390371 17:80000733-80000755 TGGGGGCATTGTGGGGGTTCAGG - Intronic
1152419319 17:80183642-80183664 TGGGGGCCTGCTGGGGAGTCTGG + Intronic
1152499600 17:80698940-80698962 TGGGTGCTTCCTGGATGTTCAGG + Intronic
1152569553 17:81115679-81115701 TGGGGAATCCCTGGGGCATCGGG + Intronic
1152609810 17:81310003-81310025 TGGGGGCTGCCTGGAGGGGCTGG - Intergenic
1152639803 17:81444747-81444769 TGGGGGCGTCCTGTGGGAGGGGG - Exonic
1152646592 17:81471782-81471804 TGGGGGCTTCCAGGAGCACCAGG - Intergenic
1152933766 17:83124294-83124316 TGGGGGCTTGTTGGGGGCACAGG + Intergenic
1153444467 18:5155868-5155890 TGGTGGCCTCCTGGGGGACCAGG + Intronic
1153969256 18:10210425-10210447 TGGGGGCTGCCTAGGGGAGGTGG - Intergenic
1155962045 18:32003092-32003114 AGGGGGCTTCCAAGGCGATCGGG - Intergenic
1157422601 18:47559190-47559212 TGGGACCTTCCTGGAGGAGCTGG - Intergenic
1157536499 18:48462520-48462542 TGGTGGCTTTCTGAGGCATCAGG - Intergenic
1158336425 18:56418076-56418098 AGGGGGCTTCCGAGGCGATCAGG - Intergenic
1158394598 18:57069855-57069877 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1159835100 18:73327122-73327144 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1160506828 18:79432049-79432071 TGGGGGCCTTCGGGGGGCTCGGG + Intronic
1160774451 19:848577-848599 GGGGGGCTTCCTGGAGGAGGTGG + Intergenic
1160875560 19:1294869-1294891 TGGGGGCTGCCTGGAGGAGGCGG + Intronic
1160963698 19:1736344-1736366 GGGGGGCTTCCTGGGGGCTCTGG - Intergenic
1161171686 19:2815389-2815411 GGGGGGCTGCCTGGGGTATCCGG - Exonic
1161411709 19:4121597-4121619 TGGGGGATTCTGGGGGGGTCAGG - Intronic
1161512579 19:4679719-4679741 CAGGGGCTCCCTGGGGGATCTGG - Intronic
1161593933 19:5141816-5141838 CGGGAGCTCCCTGGAGGATCTGG + Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1161959537 19:7516172-7516194 GGGGGGCTTCCTGCGGGCCCGGG + Exonic
1161964750 19:7541712-7541734 ACGGGGCTTCCTGGGAGATTGGG - Intronic
1162071268 19:8153675-8153697 TGGGGGCTCCAATGGGGATCTGG + Intronic
1162286719 19:9744308-9744330 TGGGGGCTTCCAAGGTGATTGGG - Intergenic
1162314194 19:9927587-9927609 AGTGGGCTTCCTGGGGGAGGTGG - Intronic
1162534423 19:11254358-11254380 TGGGGCCTTCCTGGGCCACCTGG + Intronic
1162796614 19:13090552-13090574 TGGGGGCTGCCTGGGGAGACAGG - Intronic
1163020501 19:14478656-14478678 TGAGGGCTGCCTGGGGGAGGGGG - Intronic
1163068784 19:14820385-14820407 TGGGGGCCTGTTGGGGGGTCGGG + Intronic
1163103107 19:15109306-15109328 TGGGGTCTTCCTCAGGGATGGGG - Exonic
1163173814 19:15550889-15550911 TGGGGGCCTCCTGGCGCATTGGG - Intronic
1163487337 19:17595910-17595932 AGGGGGCTTCCGAGGTGATCGGG - Intergenic
1163512048 19:17741303-17741325 TGGGAGCTTCTTGGGGGCCCTGG - Intergenic
1163598619 19:18234589-18234611 TGGAGGCCTCCTGTGGGCTCTGG + Intronic
1163900178 19:20093849-20093871 AGGGGGCTTCCGAGGCGATCGGG + Intronic
1165039028 19:33055782-33055804 TCTGGGCTTCCTGGAGGCTCCGG - Intronic
1165249286 19:34516475-34516497 AGGGGGCTTCCAAGGTGATCAGG - Intergenic
1165309603 19:35022287-35022309 GGGGGGCTTTCTGGAGGAGCAGG + Intronic
1165446846 19:35861263-35861285 GCGGGGCTTCCTAGGGGACCTGG + Intronic
1165470225 19:35999138-35999160 TGAGGGCTTCCTGGGAGTCCTGG + Intergenic
1165494224 19:36142322-36142344 AGGGGGCTTACCGGGGGCTCCGG - Exonic
1165721521 19:38082537-38082559 TGCTGGCTTCCGGGGGGCTCCGG - Exonic
1166100634 19:40569644-40569666 GGTGGCCTTCCTGGGGGATGGGG - Exonic
1166328004 19:42062911-42062933 TGGCGGCTCCCTGAGGGATGGGG - Intronic
1166531667 19:43546665-43546687 TGGGGGCTTCTGGGGTGAGCTGG + Exonic
1166655089 19:44605318-44605340 TGGGGACATGCTGGGGGATCTGG - Intergenic
1166664324 19:44669748-44669770 GGAGGGCTTCCTGGGGGAGGGGG - Intronic
1166666008 19:44680897-44680919 TGAGGGCTTCCTGGAGGAGGGGG - Intronic
1167099505 19:47395528-47395550 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1167600748 19:50453421-50453443 TGGGTGCTTCCTGAAGGATGAGG + Intronic
925235872 2:2276834-2276856 TGAGGGCTTCCAGGGGGGTGTGG - Intronic
925610417 2:5696905-5696927 CGGGAGCCTCCTGGGGGCTCCGG + Exonic
926424589 2:12729266-12729288 TGGGGGCTTCCTGGGGACATAGG + Intronic
928770778 2:34700321-34700343 AGGGGGCTTCCAAGGTGATCGGG + Intergenic
929867080 2:45727416-45727438 TGGGGGCTTCCCGGAGGACGGGG + Intronic
930289798 2:49479431-49479453 TGGGGGCCTGTTGGGGGATGGGG + Intergenic
931042663 2:58316178-58316200 AGGGGGCTTCCGAGGTGATCGGG - Intergenic
932358771 2:71088272-71088294 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
933079314 2:77967585-77967607 AGGGGGCTTCCGAGGCGATCAGG - Intergenic
933329474 2:80877691-80877713 AGGGGGCTTCCGAGGCGATCAGG + Intergenic
933787073 2:85851747-85851769 TGAGGCCTTCCTGGGAGCTCTGG - Intronic
934160183 2:89242141-89242163 GGGAGGCTTCCTGGGGGCCCTGG + Intergenic
934207092 2:89940293-89940315 GGGAGGCTTCCTGGGGGCCCTGG - Intergenic
934490703 2:94760548-94760570 TGGGGGCTTCCATGGGAATTGGG - Intergenic
935290319 2:101604663-101604685 AGGGGGCTCCCTGAGGGATGAGG - Intergenic
937076652 2:119112293-119112315 TGGGGGCTTCCTGGGTGATGTGG - Intergenic
937229003 2:120386118-120386140 TGGGGGCTTGGTGGGGGACGTGG + Intergenic
938083437 2:128382492-128382514 TGGGGGAATCCTGAGGGATTGGG + Intergenic
938302719 2:130228355-130228377 GGGGGGCTTCCTGGAGGAGGAGG - Intergenic
938453921 2:131445796-131445818 AGGGGGCTTCCCGGGGGAGGAGG + Intergenic
938453950 2:131445867-131445889 GGGGGGCTTCCTGGAGGAGGAGG + Intergenic
938501235 2:131832139-131832161 TGGGGGCTGCATGGTGGAGCTGG + Intergenic
940183726 2:150960789-150960811 CGGGGGCTTCCGAGGCGATCAGG - Intergenic
940991698 2:160103777-160103799 TGGGAGCTTCCTGGAGGAAGTGG - Intronic
941353432 2:164461596-164461618 TGGGGGCTTCCGAGGCGATCGGG - Intergenic
941456147 2:165713730-165713752 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
942097124 2:172544209-172544231 AGGGGGCTTCCAAGGTGATCGGG - Intergenic
942482786 2:176407013-176407035 TGGGTGCTTCTGGGTGGATCTGG + Intergenic
944387495 2:199181851-199181873 AGGGGGCTTCCGAGGCGATCAGG - Intergenic
944980859 2:205118360-205118382 TGGGTGTTTCCTGTGTGATCAGG - Intronic
945153055 2:206810082-206810104 AGGGGGCTTCCAAGGCGATCGGG + Intergenic
945938366 2:215924857-215924879 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
946168119 2:217877750-217877772 GGAGGGCCTCCTGGGGGACCAGG + Intronic
946525473 2:220514705-220514727 TGGGGTATTCCAGGGAGATCTGG + Intergenic
946690715 2:222306559-222306581 TCGGGGCGTCCTGGGGCAACAGG - Intergenic
946886546 2:224227772-224227794 AGGGGGCTTCCGAGGTGATCGGG - Intergenic
946893320 2:224299157-224299179 AGGGGGCTTCCGAGGTGATCGGG - Intergenic
947076901 2:226354789-226354811 TGTGAGCTGCCTGGGGGATCTGG + Intergenic
947662179 2:231877795-231877817 TGGTGGGATCCTGGGGGCTCGGG + Intergenic
947924786 2:233911704-233911726 TGTGGGCTCCCTGGGGGAAGGGG + Intergenic
948390735 2:237609437-237609459 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1169281461 20:4270803-4270825 TGGAGACTTCCAGGGGCATCTGG + Intergenic
1169316077 20:4592206-4592228 CGGGGGCTTCCTGGAGGAGGTGG + Intergenic
1169430924 20:5535595-5535617 TGTGGGCTTCCTGAGGGAAGTGG - Intergenic
1170864713 20:20142993-20143015 TGGGGGCTACCTGTGACATCAGG + Intronic
1171983753 20:31645113-31645135 TGAGGGCTTCCTGGAGGAGTGGG + Intergenic
1172429369 20:34876870-34876892 TGGGGGCTCCCTGGGGGAGTCGG + Intronic
1172932426 20:38595941-38595963 GGGGGGCTTCCGAGGCGATCGGG + Intergenic
1173781768 20:45762279-45762301 GGGGGGCTTCCGAGGTGATCGGG - Intronic
1174358756 20:50015205-50015227 AGGGGGCTTCCTGGCGGCCCTGG - Intergenic
1174572400 20:51511373-51511395 TGGGTGCTTGCTGGGGCCTCTGG + Intronic
1174656020 20:52172806-52172828 TGTGAGCTTCTTGGGGTATCGGG - Intronic
1174668345 20:52282220-52282242 TTGGGACTTCCAGGGAGATCAGG - Intergenic
1175141098 20:56860695-56860717 TGGGGGTTGCCAGGGGGAGCGGG - Intergenic
1177194839 21:17892999-17893021 TGTGGTCTACCTGGGGGCTCAGG - Intergenic
1179172750 21:38985351-38985373 TGGGGGCTTCCTAGGCAACCTGG - Intergenic
1179483194 21:41691656-41691678 TGGGCTCTGCCTGGGGGAGCTGG - Intergenic
1179577530 21:42317317-42317339 TGAGATCTCCCTGGGGGATCTGG + Intergenic
1179876562 21:44271879-44271901 TGGAGTCTGCCTGGGGGCTCAGG + Intergenic
1181922404 22:26330631-26330653 TGTGGACTTCCTGGGAGGTCAGG + Intronic
1182067999 22:27443829-27443851 TGGGGGGTTCCTGGGGATGCCGG - Intergenic
1182113997 22:27744469-27744491 TGGGGGCTTCCGAGGCGATCGGG - Intergenic
1182557487 22:31137070-31137092 TGGGGCCTCCCTGGTGGATTGGG - Intronic
1182583096 22:31327037-31327059 CGGGGGCCCCCTGGGGGACCTGG - Exonic
1183796454 22:40122503-40122525 TGCAGGCTTCCTGGGGCAGCTGG + Intronic
1184233390 22:43170262-43170284 TGGGGCCCTGCTGGGGGGTCTGG + Intronic
1184337021 22:43860040-43860062 TGGGGGCTTTCTGGTGGCTAAGG - Intronic
1184483056 22:44759346-44759368 GAGGGGCTTCCTGTGGGCTCTGG - Intronic
1184648670 22:45909645-45909667 TTTGGGCTTCCTGGTGCATCTGG + Intergenic
1184684792 22:46091380-46091402 TGAGGGCTTCCTGGAGGAAGAGG - Intronic
1184684801 22:46091416-46091438 TGAGGGCTTCCTGGAGGAAGAGG - Intronic
1184684837 22:46091560-46091582 TGAGGGCTTCCTGGAGGAAGAGG - Intronic
1184684846 22:46091596-46091618 TGAGGGCTTCCTGGAGGAAGAGG - Intronic
1184709472 22:46240067-46240089 GGGGGGCTTCCTGGGGCCTGGGG + Exonic
1185258232 22:49848433-49848455 TGGCCCCTTCCTGGGGGACCGGG - Intergenic
1185388281 22:50546529-50546551 TGGCCGCGTCCTGGGGGCTCTGG - Intergenic
950565096 3:13764640-13764662 AGAGGGCTTCCTGGAGGATGAGG + Intergenic
951050694 3:18089792-18089814 AGGTGGCTTTCTGGGGCATCAGG + Intronic
951778179 3:26333655-26333677 TGGTGGCTTCCGGGTGGCTCAGG + Intergenic
953077086 3:39581028-39581050 AGGGGGCTTCCGAGGTGATCGGG + Intergenic
953080097 3:39608755-39608777 TGGGTGCTTCCTGGGACAACAGG + Intergenic
953177240 3:40563461-40563483 AGGGGGCTTCCGAGGTGATCGGG - Intronic
953932614 3:47013228-47013250 TGTGGGCTTCCTGGGGTTGCTGG + Intergenic
954385151 3:50240249-50240271 GGGGGGCTTCCTGGAGGAGGGGG + Intronic
954396664 3:50296789-50296811 TGGGGCCTTCCTGGGTGGCCGGG + Exonic
954608853 3:51933724-51933746 TGGGGACTTCCTGGTGGCTGGGG - Exonic
954811353 3:53250273-53250295 TGAGGGCCTCCTGGGGTCTCTGG - Intronic
955089647 3:55737001-55737023 TGGAGGCTTCCTTGGGGCTGTGG - Intronic
955688483 3:61567315-61567337 TGAGGGCTTCTTGTGGGATTTGG + Intronic
957295283 3:78326288-78326310 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
957317264 3:78586371-78586393 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
957985732 3:87571825-87571847 TGTAGGCTTCCAAGGGGATCAGG - Intergenic
958473265 3:94548940-94548962 TGGGTGCTTCCCAGGGGATCAGG - Intergenic
958506934 3:94991872-94991894 TAGAGGCTTCCTGGAGCATCAGG - Intergenic
958676766 3:97276209-97276231 AGGGGGCTTCCGAGGCGATCGGG + Intronic
960925986 3:122795260-122795282 TGGGGGCCTCCTGGAGAAGCCGG + Exonic
960977286 3:123187680-123187702 TGGACGCTTGCTGGGAGATCAGG - Intronic
961096120 3:124158300-124158322 TGGGAGCTTCCTGGGAGAAGTGG - Intronic
961125259 3:124411874-124411896 TGGGGCATCCTTGGGGGATCTGG - Intronic
961204970 3:125074741-125074763 TGGGGTGTTGCTGGGGGATGTGG - Intergenic
961523645 3:127483139-127483161 AGGGGGCTTCCCGGGGGAGTAGG - Intergenic
961664088 3:128485775-128485797 CGGAGGCTTCCTGGGGGGACCGG - Exonic
961712668 3:128839407-128839429 AGGGGGCTTCCGAGGCGATCAGG + Intergenic
962105332 3:132383331-132383353 TGGGGGCTTCCTGGGCCCCCAGG + Intergenic
962523918 3:136221102-136221124 AGGGGGCTTCCGAGGTGATCGGG + Intergenic
962635333 3:137325553-137325575 TGGGGGCTTCAGGGAGGAGCTGG + Intergenic
962887198 3:139638455-139638477 TGGGGGCTTCCCTGTGTATCAGG + Intronic
963319790 3:143799768-143799790 AGGGGGCTTCCGAGGTGATCAGG - Intronic
963425265 3:145115465-145115487 AGGGGGCTTCCCAGGTGATCAGG - Intergenic
965713453 3:171578899-171578921 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
966194115 3:177296998-177297020 TGCAGGCTTCATGGGGGACCAGG + Intergenic
966860783 3:184230052-184230074 CGGGGGCCTCCGGGGGGATTCGG + Intronic
967212120 3:187178758-187178780 AGGGGGCTTCCGAGGCGATCGGG + Intronic
967244126 3:187469500-187469522 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
967496268 3:190146986-190147008 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
967735469 3:192947240-192947262 CGGGGGCTTCCAGGTGGTTCAGG + Intergenic
968086377 3:195875746-195875768 TGAGGACTTCCTGGGGGAGCAGG + Intronic
968596714 4:1489684-1489706 TGGGGGATTCCTGGGCGCCCTGG + Intergenic
968649520 4:1754944-1754966 AGGAGGCTTCCTGGGGGAGGTGG + Intergenic
968978291 4:3833345-3833367 TGTGGGCTTCCTGGAGGAGGTGG - Intergenic
969352242 4:6604467-6604489 ATGGGGATTCCTGGGGGATGGGG + Intronic
969654054 4:8486007-8486029 AGGGGGCTTCCAAGGTGATCGGG + Intronic
970854008 4:20633523-20633545 AGGGGGCTTCCGAGGCGATCAGG + Intergenic
971123141 4:23725251-23725273 TGGGGGCTTCCGAGGCGATTGGG + Intergenic
971316478 4:25572157-25572179 TGGGGGCTTCCTGGAGAAAGTGG - Intergenic
971407533 4:26335975-26335997 TGGGGGTTTGTAGGGGGATCTGG + Intronic
975865046 4:78717087-78717109 AGGGGGCTTCCGAGGTGATCAGG + Intergenic
976814028 4:89125853-89125875 TAGGGACTTCCTCAGGGATCTGG + Intergenic
977042037 4:92028140-92028162 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
977075161 4:92442194-92442216 AGGGGGCTTCCGAGGCGATCGGG + Intronic
977782397 4:100995011-100995033 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
979379985 4:119996403-119996425 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
979850264 4:125564865-125564887 AGGGGGCTTCCGAGGTGATCGGG + Intergenic
980388972 4:132120678-132120700 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
980815940 4:137946470-137946492 TGGAGGTTCCCTTGGGGATCAGG + Intergenic
981154529 4:141418149-141418171 TGGGGGCCTGGTGGGGGATGTGG - Intergenic
982180439 4:152744561-152744583 AGGGGGCTTCCGAGGCGATCGGG + Intronic
982203017 4:152976566-152976588 TGGGCGCTTCTTGGGGGCCCGGG - Exonic
982216975 4:153091045-153091067 TGGAGGCTTCCGGTGGGTTCTGG - Intergenic
982535489 4:156602764-156602786 TGGGGGCTTCTGAGGCGATCGGG - Intergenic
983360449 4:166718782-166718804 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
983414665 4:167439033-167439055 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
984165312 4:176298079-176298101 AGGGGGCTTCCGAGGCGATCAGG + Intergenic
984393571 4:179168118-179168140 AGGGGGCTTCCGAGGCGATCAGG + Intergenic
984437307 4:179722928-179722950 AGGGGGCTTCCGAGGTGATCGGG - Intergenic
984700713 4:182817000-182817022 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
985389824 4:189482692-189482714 AGGGGGCTTCCGAGGTGATCGGG + Intergenic
985662328 5:1163481-1163503 TGGGGACTTCCTGGGGGCAGAGG + Intergenic
986018130 5:3775521-3775543 TGGGGGATGCCTGGGGGCTGTGG + Intergenic
986536623 5:8794356-8794378 TGGGAGCTTCCAGTGGGGTCTGG + Intergenic
986692068 5:10321232-10321254 TGGGATCTTCCTGGATGATCTGG - Intergenic
986919544 5:12665768-12665790 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
987498079 5:18672087-18672109 AGGGGGCTTCCAAGGCGATCCGG + Intergenic
990560013 5:56974505-56974527 TGAGGACTTCCTGGTGGATTTGG + Intergenic
992122987 5:73613750-73613772 AGTGGGGTTCCTGGGGGCTCTGG - Intergenic
992132063 5:73703393-73703415 TGGGGGTTTCCCGTGGGAACAGG + Intronic
992444097 5:76819166-76819188 TCGGGGCTTCCAGGAGGATGCGG + Exonic
992451957 5:76883612-76883634 AGGGGGCTTCCGAGGTGATCAGG + Intronic
993192758 5:84700957-84700979 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
994415498 5:99464681-99464703 TGGGGCCTTTCTGGGGGCTGGGG + Intergenic
994532501 5:100987483-100987505 AGGGGGCTTCCGAGGTGATCGGG + Intergenic
996203215 5:120700819-120700841 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
996306500 5:122053571-122053593 TGGGTGCTTCCTGGGGCAATAGG + Intronic
996358577 5:122622100-122622122 TAGGGGCTTCCAAGGCGATCGGG + Intergenic
997470391 5:134114270-134114292 TGGGGGCTTCCTAGGGCTTGAGG - Intergenic
997746445 5:136303791-136303813 AGGGGGCTTCCGAGGCGATCTGG - Intronic
997772600 5:136568576-136568598 AGGGGGCTTCCAAGGTGATCGGG + Intergenic
998232639 5:140371024-140371046 TCTGGGCATCCTGGGGCATCTGG + Intronic
998995435 5:147865757-147865779 AGGGGGCTTCCGAGGTGATCGGG - Intergenic
998996357 5:147872215-147872237 AGGGGGCTTCCGAGGTGATCGGG + Intronic
999199593 5:149806240-149806262 TGAGTGCTGCCTGGGGGCTCTGG + Intronic
999618824 5:153452938-153452960 AGGGGGCTTCCAAGGCGATCGGG + Intergenic
1000935596 5:167301119-167301141 AGGGGGCTTCCGAGGTGATCGGG + Intronic
1001796705 5:174508255-174508277 TGGTGGCGTCCTTGGGTATCAGG + Intergenic
1001953016 5:175829394-175829416 GGGGCCCTTCCTGGGGGAGCGGG - Intronic
1002480699 5:179498812-179498834 TGGGTGCATGCTGGGGGATGTGG + Intergenic
1002610914 5:180417954-180417976 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1002939052 6:1699801-1699823 TGGGGACTTCCTTGGGGGTGGGG + Intronic
1003097705 6:3155697-3155719 TCGGGCCATCCTGGTGGATCTGG - Exonic
1003101389 6:3179004-3179026 TTGGGCCATCCTGGTGGATCTGG - Intergenic
1003505915 6:6740337-6740359 AGGGGGATGCCTGGGGGCTCTGG + Intergenic
1004507952 6:16262225-16262247 AGGGGGCTTCCGAGGCGATCGGG + Intronic
1004768529 6:18757298-18757320 AGGGGGCTTCCGAGGTGATCGGG + Intergenic
1005061151 6:21778159-21778181 TGTGGGCTTCCTGGGGGGTGAGG + Intergenic
1005954884 6:30656857-30656879 TGGGGGCTTCCTAGGGAACCGGG - Intronic
1006466072 6:34195763-34195785 CTGGGGCATCCTGGGGAATCTGG + Intergenic
1006813667 6:36837018-36837040 AGAGGCCTTCCTGGGGGATGTGG - Intronic
1006896727 6:37475970-37475992 GGCGGGCTTCCTGGGGGACATGG + Intronic
1007707734 6:43801302-43801324 TAGGGGCTTCCTGGAGGAGGTGG + Intergenic
1009844203 6:69115433-69115455 TGGGGCCAGACTGGGGGATCGGG + Intronic
1010285885 6:74077323-74077345 TAGGGACTTCTTGGGAGATCTGG + Intergenic
1010586651 6:77663784-77663806 AGGGGGCTTCCGAGGCGATCAGG + Intergenic
1011770896 6:90673441-90673463 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1012014347 6:93833307-93833329 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1012066499 6:94557173-94557195 AGGGGGCTTCCGAGGTGATCGGG + Intergenic
1012260290 6:97080737-97080759 ATGGAGCTTACTGGGGGATCAGG + Intronic
1012315868 6:97782080-97782102 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1013385312 6:109623915-109623937 TGGGGGCTTACGGAGGGATGTGG - Intronic
1013407845 6:109858994-109859016 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1013520042 6:110924397-110924419 TCGGGGATGCCTGGGAGATCGGG + Intergenic
1013843638 6:114425567-114425589 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1014454826 6:121623668-121623690 AGGGGGCTTCCAAGGCGATCGGG + Intergenic
1014555892 6:122842310-122842332 AGGGGGCTTCCGAGGAGATCGGG - Intergenic
1014718941 6:124894519-124894541 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1014891586 6:126851225-126851247 ACAGGGCTTCCGGGGGGATCAGG - Intergenic
1015266782 6:131297933-131297955 AGGGGGCTTCCGAGGGGATCGGG - Intergenic
1015287999 6:131507513-131507535 AGGGGGCTTCCGAGGGGATCGGG + Intergenic
1016373331 6:143396161-143396183 TGGGGACTTCCAGAGGGATCAGG - Intergenic
1016444081 6:144114881-144114903 TGGGGACTTACTGGGGCATAAGG + Intergenic
1017258311 6:152359785-152359807 AGGGGGCTTCATGGGGGCTGGGG - Intronic
1017389548 6:153923966-153923988 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1018084451 6:160289804-160289826 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1019331514 7:462895-462917 TGGGGGCTTCCCGGGGGGGAGGG + Intergenic
1019713453 7:2527784-2527806 TGGGGGCTTCGTGGGGCCACTGG - Exonic
1019813036 7:3178953-3178975 TGGGGAGTTCCGGGTGGATCGGG + Intergenic
1020137448 7:5594791-5594813 TAGGGGCTTCCCGAGGGAGCTGG - Intronic
1021496172 7:21276723-21276745 TGGGGGCTTCCTGTTGCATGAGG + Intergenic
1022105015 7:27191245-27191267 TGGGGGCTTCCTGTGAGCTACGG - Intergenic
1022469071 7:30670850-30670872 TGTGGGCTTCCAGGGGCATTAGG + Intronic
1023050336 7:36245539-36245561 TGGGGGCCCCTTGTGGGATCAGG + Intronic
1024645778 7:51369245-51369267 TGGGTGTTTCCTGGAGGAACAGG - Intergenic
1024912595 7:54463172-54463194 TGTGTGCCTCCTTGGGGATCTGG - Intergenic
1025036636 7:55597362-55597384 TGGGTGTTTCCTGGAGGAACAGG - Intergenic
1026235333 7:68521919-68521941 TGGGGGGTTCATGTGGGATGGGG + Intergenic
1026453701 7:70552779-70552801 TGTGGGCTTCCTGGAGTAACAGG + Intronic
1026631681 7:72043322-72043344 AATGGGCTTCCTGGGGGTTCTGG - Intronic
1027055825 7:75048653-75048675 AGGGCGCTCCCTGGGGGATGAGG + Intronic
1027851992 7:83462142-83462164 AGGGGGCTTCCGAGGTGATCGGG - Intronic
1028433248 7:90772386-90772408 TTGAGGCTTCCTGGGTGATATGG + Intronic
1029274526 7:99396375-99396397 TGGGGGGTGCCTGGGAGATGGGG - Exonic
1029317205 7:99725749-99725771 GGGGGGCTTCCGAGGTGATCGGG - Intronic
1029481172 7:100813880-100813902 TGAGGGCTTCCAGGGGCCTCTGG + Intronic
1029634845 7:101776892-101776914 TGTGGGCTTCCTGGAAGCTCTGG + Intergenic
1031355147 7:120780373-120780395 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1031465669 7:122107736-122107758 TGGGGCCTTCCTGAGGGAGAAGG + Intronic
1031506633 7:122592825-122592847 TGGGGCCTTCCAGGGGGATGGGG + Intronic
1031525636 7:122819402-122819424 AGGGGGCTTCCAAGGCGATCGGG - Intronic
1031685892 7:124731513-124731535 AGGGGGCTTCCGAGGTGATCGGG - Intergenic
1031704571 7:124963871-124963893 AGGGGGCTTCCAAGGTGATCGGG + Intergenic
1031776365 7:125912470-125912492 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1032487564 7:132299429-132299451 TGGGAGCCTTCTGGGGGACCTGG - Intronic
1032879464 7:136073943-136073965 TGGGAGATTCCTGGGTTATCTGG + Intergenic
1033654403 7:143362895-143362917 GGGGCGCTCCCTCGGGGATCTGG + Intergenic
1033679370 7:143578973-143578995 TGGGGGGTGCCTGAGGGCTCAGG - Intergenic
1033692467 7:143750471-143750493 TGGGGGGTGCCTGAGGGCTCAGG + Intergenic
1034084787 7:148313283-148313305 AGGGGGCTTCCGAGGTGATCGGG + Intronic
1034489816 7:151387235-151387257 AGGAGGCTTCCTGGGTGACCAGG + Intronic
1034786263 7:153928669-153928691 TGGGGCCTTCCAGGATGATCAGG - Intronic
1035067842 7:156121248-156121270 TGAGGGCTTCCTGCAGGATGGGG - Intergenic
1035080303 7:156210207-156210229 TGGGGGCATCCATGGGGCTCAGG + Intergenic
1035325034 7:158060346-158060368 TGGGGGCTGCATGGGAGATGGGG - Intronic
1036702995 8:11025518-11025540 TGGGGGCGGCCTGGGGGAGATGG + Intronic
1038170710 8:25128860-25128882 TGGGGGCTTGCTGTGGGCCCAGG - Intergenic
1038646307 8:29365319-29365341 TGGGGGCTTCCTTGAGGTCCAGG + Intergenic
1039568792 8:38570093-38570115 TGGGGGCTGCCTGGGGAGCCAGG + Intergenic
1041220716 8:55648499-55648521 TGGGTGCTTCCTGGGACAACAGG + Intergenic
1041220761 8:55648772-55648794 TGGGTGCTTCCTGGGACAGCAGG + Intergenic
1041917499 8:63151564-63151586 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1042453603 8:68975652-68975674 AGGGGGCTTCCGAGGGGATTGGG - Intergenic
1042604745 8:70534197-70534219 TGGGGGCTCCACTGGGGATCAGG - Intergenic
1043354969 8:79401556-79401578 TGGGGGGTTCGTGGGGGGGCGGG - Intergenic
1044922037 8:97177556-97177578 AGGGGGCTTCCGAGGCGATCAGG - Intergenic
1045197569 8:99946351-99946373 AGGGGGCTTCCAAGGTGATCGGG - Intergenic
1045510279 8:102807720-102807742 CGAGGGCTTCCTGGTGGAGCTGG + Intergenic
1045644824 8:104288415-104288437 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1046294161 8:112198304-112198326 ACGGGGCTTCCTAGGTGATCGGG - Intergenic
1046382135 8:113465189-113465211 TTGGGGCCTGTTGGGGGATCGGG + Intergenic
1046512131 8:115214707-115214729 TAGGGGCTTCCGAGGCGATCGGG - Intergenic
1048518478 8:135132320-135132342 AGGGAGCTGCCTGGGGGATCCGG + Intergenic
1049165738 8:141124641-141124663 TGAGGGCTTGATGGGGGATATGG - Intronic
1049276635 8:141723390-141723412 TTGGGGCTGCCTGGGGCATAGGG - Intergenic
1049313904 8:141948611-141948633 AGGGGGCTTTCTGGGGGATCTGG + Intergenic
1049397469 8:142407956-142407978 TGGGGGCACCCGGGGGGATGGGG + Intergenic
1051187821 9:14479236-14479258 TGGGGGATTGCAGGGGGCTCTGG + Intergenic
1051705852 9:19878875-19878897 TGGGGGTTTTCTGGGGGAGAAGG - Intergenic
1051849241 9:21488934-21488956 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1053667290 9:40325146-40325168 TGGGGGCTTCCATGGGAATTGGG + Intronic
1053916871 9:42950251-42950273 TGGGGGCTTCCATGGGAATTGGG + Intergenic
1054143055 9:61543590-61543612 TGGGGGCTGCCTGGGGCAGGGGG + Intergenic
1054378435 9:64465174-64465196 TGGGGGCTTCCATGGGAATTGGG + Intergenic
1054517320 9:66051137-66051159 TGGGGGCTTCCATGGGAATTGGG - Intergenic
1054928633 9:70613809-70613831 TGGTGGCTTCTTGAAGGATCAGG + Intronic
1055810093 9:80139891-80139913 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1056323931 9:85461124-85461146 AGGGGGCTTCTGGGGCGATCGGG - Intergenic
1056883023 9:90415054-90415076 CGGGGGCTTCCGAGGCGATCGGG - Intergenic
1057195773 9:93115102-93115124 TGAGGGCTTCCTGGAGGAAGTGG - Intergenic
1057234891 9:93350087-93350109 AGGGGGCTTCCAAGGCGATCGGG - Intergenic
1057894281 9:98894667-98894689 TGAGGGCTGCCTGGGGGTTGGGG + Intergenic
1057982127 9:99672640-99672662 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1058026165 9:100143922-100143944 AGGGGGCTTCCGAGGCGATCGGG + Intronic
1058450596 9:105092707-105092729 TGGGGACTTCCTGAGAGACCTGG + Intergenic
1059283325 9:113152581-113152603 TGGAGGCTCCCTGGGGGTGCTGG - Intronic
1060226239 9:121792806-121792828 AGGGGGCTTCCGAGGCGATCTGG - Intergenic
1061004755 9:127922142-127922164 CTGGGGCTTCCTGGAGGAGCTGG - Intronic
1061674646 9:132208876-132208898 TGGGGGCTTCCAGGGGTCTCGGG - Intronic
1061679531 9:132236130-132236152 AGGGGGCTTCCTGCAGGAGCGGG + Intronic
1062010858 9:134265933-134265955 TGGGGGCTCCCTGGAGGGGCAGG - Intergenic
1062084930 9:134643554-134643576 TGGGGGCTGCCCTGGGGCTCTGG + Intronic
1062108857 9:134771152-134771174 TGGGGGCTTCCTCGAGCAGCCGG + Intronic
1203761310 EBV:13869-13891 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203762239 EBV:16941-16963 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203763168 EBV:20013-20035 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203764097 EBV:23085-23107 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765026 EBV:26157-26179 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765955 EBV:29229-29251 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203766884 EBV:32301-32323 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1186153998 X:6706972-6706994 TAGGTGCTTCTTGGGGGATGAGG + Intergenic
1186411366 X:9347270-9347292 TGGGAGTTTCCTGGGGGAGAAGG - Intergenic
1188200928 X:27292371-27292393 AGGGGGCTTCCAAGGCGATCGGG + Intergenic
1189031765 X:37458996-37459018 AGGGGGCTTCCAAGGCGATCGGG + Intronic
1189175560 X:38953772-38953794 TGGGGACTTCTTTGGGAATCTGG + Intergenic
1191761317 X:64651391-64651413 AGGGGGCTTCCAAGGTGATCAGG - Intergenic
1191762851 X:64663416-64663438 TGGGTGTTTCCTGGGACATCAGG - Intergenic
1193309139 X:79985069-79985091 TGGGGCCTGTCTGGGGGACCAGG - Intergenic
1193941543 X:87684372-87684394 AGGGGGCTTCCGAGGTGATCGGG - Intergenic
1194308499 X:92276296-92276318 TAGGGGCTTCCGAGGCGATCGGG + Intronic
1194351333 X:92826974-92826996 TGGGGGCTTCCGAGGCGATCGGG - Intergenic
1194367151 X:93025412-93025434 AGGGGGCTTCCGAGGTGATCGGG - Intergenic
1194873753 X:99162664-99162686 AGGGGGCTTCCGAGGAGATCCGG + Intergenic
1194981976 X:100450349-100450371 TGGGTGCTTCCTGGGACAACAGG - Intergenic
1196165588 X:112533095-112533117 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1196227175 X:113180027-113180049 AGGGGGCTTCCGAGGCGATCGGG + Intergenic
1196330870 X:114469246-114469268 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1196341672 X:114604529-114604551 AGGGGGCTTCCGAGGCGATCGGG + Intronic
1196572542 X:117281632-117281654 AGGGGGCTTCCGAGGCGATCGGG - Intergenic
1197787903 X:130218307-130218329 TGACCTCTTCCTGGGGGATCAGG + Intronic
1197834571 X:130680875-130680897 TGGGAGCCTCCTTGGGTATCAGG + Intronic
1198598486 X:138261288-138261310 TGGGGGCTTCCGAGGTGATCGGG - Intergenic
1200022741 X:153225814-153225836 TCGGGCCTTCCTGGGAGACCCGG + Intergenic
1200102583 X:153695315-153695337 TGGGGTCTGCCTGGGGGAGGAGG + Exonic
1200219338 X:154383507-154383529 TGAGTGCTTCCTGGGGGAACTGG - Intergenic
1200675364 Y:6141668-6141690 AGGGGGCTTCCGAGGTGATCAGG - Intergenic
1200705038 Y:6435461-6435483 TGGGGGCTTCCTGCAGAACCAGG - Intergenic
1201029073 Y:9729247-9729269 TGGGGGCTTCCTGCAGAACCAGG + Intergenic
1201497745 Y:14607381-14607403 CCGGGGCTTCTTGGGGGATGGGG - Intronic