ID: 903373796

View in Genome Browser
Species Human (GRCh38)
Location 1:22853380-22853402
Sequence GGGGCTGGTGCCAGACCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903373786_903373796 14 Left 903373786 1:22853343-22853365 CCTGAAGCCTCTATCGATCACCT 0: 1
1: 0
2: 1
3: 3
4: 65
Right 903373796 1:22853380-22853402 GGGGCTGGTGCCAGACCTCGGGG 0: 1
1: 0
2: 3
3: 25
4: 234
903373787_903373796 7 Left 903373787 1:22853350-22853372 CCTCTATCGATCACCTCTCAGCC 0: 1
1: 0
2: 1
3: 10
4: 84
Right 903373796 1:22853380-22853402 GGGGCTGGTGCCAGACCTCGGGG 0: 1
1: 0
2: 3
3: 25
4: 234
903373791_903373796 -6 Left 903373791 1:22853363-22853385 CCTCTCAGCCAGACACTGGGGCT 0: 1
1: 0
2: 3
3: 44
4: 350
Right 903373796 1:22853380-22853402 GGGGCTGGTGCCAGACCTCGGGG 0: 1
1: 0
2: 3
3: 25
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903373796 Original CRISPR GGGGCTGGTGCCAGACCTCG GGG Intronic
900166702 1:1246865-1246887 GGGGCTGGAGCGGGACCCCGGGG - Intergenic
900177069 1:1295649-1295671 GGGGCTGGTGGCAGGGCTCTGGG - Intronic
901033869 1:6324614-6324636 GGGGTAGGTGCCAGACCCCGGGG - Intronic
901772542 1:11537657-11537679 GGGGCTGGTGCCAGAGGGAGAGG + Intergenic
902783994 1:18721332-18721354 GGGGCTGGTCCCAGGCCTTGGGG - Intronic
903164978 1:21514029-21514051 GGGGCTTGGGCCAGCCCTCAGGG + Intronic
903373796 1:22853380-22853402 GGGGCTGGTGCCAGACCTCGGGG + Intronic
903543749 1:24111006-24111028 GGCGCTCGTCCCTGACCTCGGGG + Intronic
904259414 1:29279868-29279890 GGGGCTGGTGCCTGAGGTCAGGG + Intronic
904567440 1:31436046-31436068 GGGGCAGGTGCCAGGGCTCAGGG + Intergenic
904615229 1:31745952-31745974 GGGGCTGGTGACTGACGTGGAGG - Intronic
904701998 1:32363165-32363187 GGGGCTGGTGCCAAGGCCCGTGG + Intronic
904841061 1:33372245-33372267 GAGGCTGGTGCCAGGCATCCTGG - Intronic
905271559 1:36790914-36790936 AGGGCAGGTCCCAGACCTAGAGG + Intergenic
905640197 1:39584060-39584082 GGTGCTTGGGCCAGACCTCTAGG - Intergenic
905945126 1:41895335-41895357 AAGGCTGGGGCCAGACCACGTGG - Intronic
907425589 1:54377265-54377287 GGGCCTGGAGGCAGACCTTGTGG - Intronic
909608901 1:77532767-77532789 GAGGCTGGTGCCAGAGCCCCAGG + Intronic
909957718 1:81800820-81800842 GGAGCTGGAGGCAGAGCTCGGGG + Intronic
910163494 1:84298802-84298824 GGGGCTGCTGGCAGTGCTCGGGG + Intronic
912515334 1:110213242-110213264 GGGGCTGGTGTCGGATCTCATGG + Intronic
917315020 1:173715222-173715244 GGCGCTGGGGCCGGGCCTCGCGG + Intronic
920285177 1:204873948-204873970 GGGGTTGGAGCCAGACTGCGGGG + Intronic
920937196 1:210446557-210446579 GTGGCAGGTGCCGGACCACGTGG - Intronic
922731293 1:227949867-227949889 GGTGCTGGAGCCAGACTTTGGGG - Intergenic
922753727 1:228082819-228082841 GGGGCTGGGGACTGGCCTCGGGG + Intronic
923783219 1:237043219-237043241 GGGGCTGGTGCCATCCGTGGTGG + Intronic
1062910369 10:1208363-1208385 GTGGCTGGTGCCACCCCCCGGGG + Intronic
1065380410 10:25084307-25084329 GAGGCTGGTGCCAGCCCTCAAGG - Intergenic
1067088251 10:43254012-43254034 GAGGATGGTGCCAGACCCCATGG - Intronic
1069371337 10:67750735-67750757 GGGGCTGGTGAAAGCCCTTGGGG + Intergenic
1070011388 10:72478154-72478176 GGGGCTGAGGCCAGACGCCGTGG - Intronic
1072022367 10:91414844-91414866 GGGGCTGGAGCCAGATCACTAGG + Intronic
1072220767 10:93325870-93325892 GGGGCTGGTCCCTGAGCACGTGG - Exonic
1072715973 10:97752932-97752954 CCGGCTGCTGCCACACCTCGTGG + Intronic
1072922968 10:99592098-99592120 GGGGCTGCTGCCAGCCCCTGTGG + Intergenic
1074780367 10:116798061-116798083 GGGGCTGGGACCAGATCACGTGG + Intergenic
1075463276 10:122632609-122632631 GGGGCAGGGGCCAGACTTCCAGG + Intronic
1075560131 10:123462054-123462076 GGAGCTGATGGCTGACCTCGGGG - Intergenic
1076016347 10:127030375-127030397 GTGGCTGGTGACAGACAGCGAGG - Intronic
1076143634 10:128098903-128098925 GTGGGTGGTGACAGACCTCAAGG + Exonic
1076314448 10:129530930-129530952 AGGGCTGGGGCCACACTTCGGGG - Intronic
1076443746 10:130497972-130497994 GAGGCTGGTCCCAGATCTCAAGG + Intergenic
1076530713 10:131142656-131142678 GGGTCTGATGCCAGACCTGAGGG - Intronic
1077058610 11:607996-608018 GAGGCCGGGGCCAGACCTCTCGG - Exonic
1078617742 11:12881085-12881107 CGGGCTGGTCCCAGCCCACGTGG + Intronic
1081756005 11:45545018-45545040 GGGGCTGGTGACAGAGCTAAAGG - Intergenic
1083371568 11:62186312-62186334 GGGCCTGGTACCAGGCCTCCAGG - Intergenic
1083595638 11:63917285-63917307 GGGGCCGGGGCCAGACCTCCAGG + Intergenic
1083881887 11:65553050-65553072 GGGGCTGGGGCAAGACCCTGAGG - Intronic
1085477320 11:76796593-76796615 GGGGCTGGAGCCAGGCCTCCGGG - Exonic
1087046898 11:93850325-93850347 GGGGCCGCTGCTAGACCCCGGGG + Intronic
1087672998 11:101128493-101128515 CGGGCTGGTGACAGGCCCCGGGG + Exonic
1087791784 11:102413571-102413593 AGGCCTGGTCCCAGACCTCCAGG + Intronic
1088824508 11:113482615-113482637 GGTGCAGGTGACAGACCTGGAGG - Intergenic
1089627015 11:119757731-119757753 GGGGCTGGTTCCAGATCCCAGGG - Intergenic
1091074919 11:132606539-132606561 GGGGGTGGTGGCAGCCCTCCTGG - Intronic
1091169995 11:133511529-133511551 CTGGCTGGTGCAAGACCTCAGGG - Intronic
1091454003 12:591744-591766 GGGGGTGCTGCCAGACTTTGTGG + Intronic
1091551056 12:1535091-1535113 GGGGCTGGTGCCTGAGTTCTAGG + Intronic
1096302977 12:50448150-50448172 GGGGCTGGGGCCAGACCTGGTGG - Intronic
1100759813 12:97794887-97794909 GGGGCAGGTTCCAGAACTCTGGG - Intergenic
1103410672 12:120709819-120709841 GGGACTGGTGACAGAACTCTTGG + Intergenic
1105068471 12:133219344-133219366 GGGGCTGGGGCCAGCTCTGGAGG + Exonic
1108088248 13:46818315-46818337 AGGGTTGGGGCCAGACCCCGGGG + Intergenic
1112433949 13:99377191-99377213 AGGCCTGGTGCCAGCCCTCAAGG + Intronic
1113561667 13:111286491-111286513 GGAGCTGGGGCCGGACCTGGAGG + Intronic
1119700361 14:76750565-76750587 GGGGCTGATCCCGGACGTCGCGG - Intergenic
1122412417 14:101532488-101532510 GGGGATGGTGACAGGCATCGTGG + Intergenic
1122606529 14:102950340-102950362 GGCCCTGGTGCCAGTCCTAGGGG - Intronic
1122890903 14:104731813-104731835 GGGGATGGTGACAGGACTCGGGG + Intronic
1125726363 15:41870257-41870279 GGGGCTGGAGCGAGAACTCGTGG - Exonic
1127485358 15:59413252-59413274 GGGCCAGGTGCCAGACAACGAGG - Intronic
1128353954 15:66911431-66911453 GAGGCTGGAGCCAGGCCTGGAGG - Intergenic
1128357658 15:66939573-66939595 GGGTCTGGTGGCAGAGCTCTGGG - Intergenic
1129198615 15:73985462-73985484 GGGGCTGGAGGTAGACCGCGTGG - Exonic
1129405344 15:75313308-75313330 GGGGCTGGAGGAAGACCTCATGG - Intergenic
1129479002 15:75808233-75808255 GGGGCTGGAGGGAGACCTCATGG - Intergenic
1129875644 15:78973740-78973762 GGGGCTGGTGACAGAGCCCAGGG - Intronic
1132383127 15:101380368-101380390 GGGTCTGGTTCCTGACCTGGGGG - Intronic
1132396034 15:101475036-101475058 GGCGCTAGGGCCAGACCTGGAGG - Intronic
1132897459 16:2235864-2235886 GGGGCTTCTGCCAGCCCTGGCGG + Exonic
1134693645 16:16207249-16207271 GGGGCTGGTGCCATGACTGGTGG - Intronic
1134978201 16:18587394-18587416 GGGGCTGGTGCCATGACTGGTGG + Intergenic
1136395884 16:29992155-29992177 GGGGCTGCTCCCAGGCCTGGGGG + Intronic
1136601933 16:31297920-31297942 GGGGCTGATGCCAGATCCTGAGG - Exonic
1136628583 16:31476604-31476626 GGGGCTGGGGCGAGACGTCGAGG - Intronic
1138107906 16:54300157-54300179 GGGTCTGGAGCCAGACCTTCAGG + Intergenic
1138502327 16:57455048-57455070 GGGGCTGCTGCCAGACATACAGG + Intronic
1138991245 16:62392961-62392983 GGGGCTGGTGCCTGCCCCAGGGG + Intergenic
1141076934 16:81015284-81015306 GGCCCTGGGGCCAGACCTCTTGG + Intronic
1141146160 16:81531613-81531635 GAGGCTCGGGCCACACCTCGAGG + Intronic
1141318028 16:82980047-82980069 GGGGGTGGTGCCATCCCTTGTGG - Intronic
1141620912 16:85236046-85236068 GGGGCTGGTGCCGCCCCTCCCGG + Intergenic
1141644443 16:85359748-85359770 GGCGCGGGAGCCAGACGTCGGGG - Intergenic
1141982903 16:87560982-87561004 GGGGCTGGAGCTAGGCCTGGAGG + Intergenic
1142478229 17:202265-202287 GGGTCTGGTTCCAGGCCTTGCGG + Intergenic
1142996180 17:3761857-3761879 GAGGCTGGTGCTAGCCCTCGTGG - Intronic
1144839111 17:18174791-18174813 GGTGCTGGGCCCAGACCTGGAGG - Intronic
1145737703 17:27244654-27244676 GGGGCCTGTGCCAGACCTTAGGG - Intergenic
1146352986 17:32111483-32111505 GGGGCTGGTGCCAGAGCCCCAGG - Intergenic
1147556476 17:41482390-41482412 GGAGCAGGGGCCAGACTTCGGGG - Intergenic
1149313989 17:55421858-55421880 AGGGCTGGGGCCAGACCGGGCGG + Exonic
1150302152 17:64055697-64055719 GGGGCTGCTGCCAGCCTTGGAGG + Exonic
1151456023 17:74226271-74226293 GGGGCTGGGGCCAAGCCTGGAGG + Intronic
1151555265 17:74843305-74843327 TGGGCTGGGGCCAGACCGCGGGG + Exonic
1151876460 17:76870136-76870158 GGGGCTGGGCCGAGACCTGGAGG - Intronic
1151913194 17:77098054-77098076 GGGGCTGAGGCCAGATCTCATGG + Intronic
1152701112 17:81820120-81820142 GGTGCTGGGGCCATACCTGGGGG + Intergenic
1152703334 17:81830347-81830369 GGGGCTGGGGCCAGGCGTGGTGG + Intronic
1152848267 17:82615846-82615868 GGGGCTGGTGCCAGTGCCCCAGG - Exonic
1153102592 18:1490624-1490646 GGAGCTGGAGCTAGAACTCGAGG + Intergenic
1153140986 18:1972240-1972262 GGGGCTGGTTCCAGGCCTGGTGG - Intergenic
1155067450 18:22280026-22280048 GGGGCTGGGGACACACCTCGGGG + Intergenic
1155226000 18:23729825-23729847 GGCTCTGGTGCCAGACTTGGGGG - Intronic
1157603880 18:48913504-48913526 TGGGCTCGTGCCTGACCTCAAGG + Intergenic
1158437807 18:57446153-57446175 GGGGCTCGGGCCAGCCCTCTGGG + Intronic
1158901260 18:61963894-61963916 GGGGCTGTTGCCAGACCTCTGGG - Intergenic
1159036945 18:63286567-63286589 TGGGCTGGTGCCAGCCCTGAAGG + Intronic
1159351918 18:67286466-67286488 GCAGCTGGTGCCTGACCTCCAGG - Intergenic
1160803866 19:982908-982930 GAGGCTGGTGCCAGAGCGTGCGG - Intergenic
1160893721 19:1393162-1393184 GGGGATGGGGCGAGGCCTCGTGG + Intronic
1160905825 19:1451384-1451406 GGGGCTCGAGCCAGACCCCAGGG + Exonic
1160914410 19:1489952-1489974 GGGGCTGTTACCGGCCCTCGGGG - Intronic
1160936748 19:1599698-1599720 GCTGCTGGTGCCAGCCCTCAGGG - Intronic
1161213338 19:3079812-3079834 GGGGCTGGTGCAGGCCCTTGTGG + Intergenic
1161240649 19:3221492-3221514 GTGGCTGGTGCAAGACCACACGG - Intergenic
1161514672 19:4689899-4689921 GGGGCTGCTCCCAGCCCACGGGG - Intronic
1161563153 19:4984851-4984873 GGAGCAGGTGCCAGACCCCCAGG - Intronic
1161717893 19:5887070-5887092 GGGGCTGGAGCCAGGCATGGTGG - Intronic
1161975420 19:7605703-7605725 AGGGGAGGAGCCAGACCTCGTGG - Intronic
1162145245 19:8609323-8609345 GGGGAGGGTGCCAGGCCTGGAGG + Intronic
1162332547 19:10039091-10039113 GGGGCTGGTGACTGCCCTCTGGG - Intergenic
1163578303 19:18123380-18123402 GGGGCTGGGGCCAGAGGTCGCGG - Intronic
1165906255 19:39196599-39196621 GGGGCTGGTGCCTGGACTCCTGG + Intergenic
1165906278 19:39196672-39196694 GGGGCTGGTGCCTGGACTCCTGG + Intergenic
1167153757 19:47725587-47725609 GGGGCTGGGGCCAGAGCGAGGGG + Intronic
1167404176 19:49293459-49293481 AGGGCTGGTGGCAGACCCAGTGG + Intronic
1167730777 19:51252789-51252811 AGGGCTGGTTCCAGAACTCTGGG + Intronic
1168246179 19:55114099-55114121 GGGGCTGGGGCCTGGACTCGTGG - Intronic
1168464236 19:56589282-56589304 GGGGCTGGAGGCTGACCTCTGGG - Intergenic
925006504 2:447193-447215 GGGGCAGGTGCCAGCCCTGAAGG - Intergenic
925157423 2:1658476-1658498 GGGGCTGGTCCCTGGGCTCGTGG - Intronic
925448235 2:3946259-3946281 GGGGCAGGGGCCAGGCCTGGAGG + Intergenic
927422079 2:22944324-22944346 GGGGTTGGTGCCAGAGCCTGTGG - Intergenic
928540283 2:32278095-32278117 GCGGCTGGGCCCAGACCCCGAGG - Exonic
930694359 2:54396348-54396370 GGGGCTTGTGCCAAATCTCCAGG + Intergenic
931665273 2:64606061-64606083 GGGCCTGGAGCCAGACCCCCTGG - Intergenic
934614406 2:95762384-95762406 GGTGCTGGTGCCAGGCAGCGGGG + Intergenic
934646496 2:96062115-96062137 GGTGCTGGTGCCAGGCGGCGGGG - Intergenic
934738152 2:96700405-96700427 GGGGCTGGTACCTGAGCACGTGG + Intergenic
934746454 2:96762651-96762673 AGGGCTGGAGCAAGACCTCAGGG + Intronic
934839897 2:97618197-97618219 GGTGCTGGTGCCAGGCGGCGGGG - Intergenic
937288740 2:120769178-120769200 GGAGCTAGTGCCAGACCACCAGG - Intronic
946360984 2:219219174-219219196 GGGGCTGGAAACAGACCTCACGG + Intronic
946865737 2:224039536-224039558 CGGGCTGGCGCCGCACCTCGGGG - Intergenic
947741147 2:232485551-232485573 GGGGCCAGCTCCAGACCTCGCGG + Intronic
948787853 2:240362422-240362444 GCGGCAGGTCCCAGACCACGTGG - Intergenic
948826101 2:240574075-240574097 GGTGAGGGTGGCAGACCTCGGGG - Intronic
949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG + Intergenic
1169209189 20:3756194-3756216 GTGGCTGGTGCCAGGCCTGTGGG - Intronic
1174088199 20:48025297-48025319 GGGGCTCGTGCCAGCCCTGAAGG + Intergenic
1175160267 20:57003061-57003083 GGGGTTGGTGTCAGAGCTCCGGG + Intergenic
1175164181 20:57031450-57031472 GGGAATGGTGCCAGATCTCCTGG - Intergenic
1175398517 20:58685006-58685028 GGGGCTGGGGCCAGGCATGGTGG - Intronic
1175483934 20:59331277-59331299 GGGGCTGGACCCAGACCAGGAGG - Intergenic
1176008675 20:62880434-62880456 TGGGATGGTGCCACTCCTCGTGG + Exonic
1179615770 21:42582286-42582308 GGGGCTGGTGCCCGTCCTCAGGG - Intergenic
1180034214 21:45235017-45235039 CTGGCTGGTGCCAGGCCTCGGGG - Intergenic
1180159042 21:45990915-45990937 GGGGCTGCTGCCAGAGGCCGCGG + Intronic
1181551100 22:23639495-23639517 GGGGCTGCTAACAGACTTCGGGG + Intergenic
1181886289 22:26024720-26024742 GGAGCTCCTGCCAGACCTGGAGG + Intronic
1182260450 22:29070366-29070388 GGGGCTGCTGCCAGCCCAGGAGG + Intergenic
1182419816 22:30243520-30243542 GGGGCTGCTGGCAGACCCCGAGG - Exonic
1183184142 22:36282232-36282254 GGCGCTGGTGGCAGACGTCAGGG + Exonic
1183429553 22:37757493-37757515 GGGGCTGGAGACAGACCCCAGGG - Intronic
1183709994 22:39497572-39497594 TGGGCTGGTGTCAGCCCTCATGG - Intergenic
1184453688 22:44597447-44597469 GGGGCTGGTGCGGGGCCTGGGGG - Intergenic
1184645067 22:45891091-45891113 GGGGCTGCGGCCAGAGCTCCTGG - Intergenic
1184957279 22:47898178-47898200 GGGGCAGGTACCAGAGCTGGTGG + Intergenic
1185238469 22:49727963-49727985 GGGAGTGGTCCCAGCCCTCGTGG + Intergenic
949962288 3:9322454-9322476 TGGACTGGTGCCAGTCCCCGTGG + Intronic
950453302 3:13077944-13077966 GGGACCGATGCCAGCCCTCGTGG - Intergenic
950668806 3:14513073-14513095 GGGGCTGGAACCAGGCCTCTTGG + Intronic
953621379 3:44535679-44535701 TGGGCTGGTGCCAGGCCTAAAGG - Intergenic
954125344 3:48524959-48524981 GGGTCTGGTGCCAGGGCTGGGGG + Intronic
954388167 3:50255226-50255248 GAGGCTGGTCCCAGGCCTCCAGG - Intronic
956125671 3:66008817-66008839 GGGGCAGGGGCCAGACCATGAGG + Intronic
956411779 3:68986792-68986814 GGGGAAGGTGCCTGACCTCATGG - Intronic
957568087 3:81909931-81909953 TGGGCTGATGCCAGACCCCAAGG - Intergenic
961182389 3:124887059-124887081 GGGGCTGGGGCCGGAGCGCGGGG + Exonic
961385126 3:126518824-126518846 GGTGCTAGAGCCAGACCTCTGGG - Intergenic
961605880 3:128095098-128095120 GGGGCTGGGGCCAAATCTCCCGG + Intronic
962347189 3:134626665-134626687 GGGGCTGGAGCCAGGTCTAGAGG - Intronic
963993220 3:151677552-151677574 GAGGCTGGTCCCAAACCTCTGGG + Intergenic
965488802 3:169312018-169312040 GGAGCTGGGCCCAGACCACGCGG + Intronic
966613005 3:181886859-181886881 GGGGACAGTGCCAGAACTCGTGG - Intergenic
968628173 4:1637401-1637423 GGGGGTGAGGCCAGCCCTCGAGG + Intronic
968628871 4:1640125-1640147 GGGTGTAGTGCCAGACCTCTGGG - Exonic
968656321 4:1779874-1779896 GGGGCTGCTCCCAGCCCTGGGGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969870026 4:10098830-10098852 GGGGCTGCAGCCAGCCCTCACGG + Intronic
985493365 5:191802-191824 GGCGCTGGTGCGCGGCCTCGCGG + Exonic
988486038 5:31668930-31668952 GGGGCTGGGGCTGGACCTCAGGG + Intronic
988771708 5:34439363-34439385 GGGGCTGGTGCTAGAAGTAGAGG - Intergenic
996888894 5:128393293-128393315 AGTGCTGGTTCCAGACCTGGAGG - Exonic
998176528 5:139904947-139904969 GGGGCTGAGGCCAGACCTGCAGG - Intronic
998284971 5:140850439-140850461 GGTGCTGGTGAAAGACCACGGGG + Exonic
999745039 5:154585457-154585479 GAGACTTGTGCCAGACCTGGGGG - Intergenic
1000910226 5:167013022-167013044 TGGGCAGGGGCCAGACCTTGTGG + Intergenic
1001565402 5:172696557-172696579 TGGGGTCGTGCCAGGCCTCGGGG + Intergenic
1002641012 5:180630699-180630721 GGGGGTGGTGCGAGACTGCGAGG - Exonic
1005511709 6:26517815-26517837 GGCACTGGGGCAAGACCTCGGGG + Intergenic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006834030 6:36986085-36986107 GGAGCTGGAGCCGGAGCTCGCGG - Exonic
1007809149 6:44474168-44474190 AGGGCTGGTGGCAGACCCCGTGG + Intergenic
1007809166 6:44474222-44474244 AGGGCTGGTGGCAGACCCCGGGG + Intergenic
1007809176 6:44474249-44474271 AGGGCTGGTGGCAGACCCCGGGG + Intergenic
1007809184 6:44474276-44474298 AGGGCTGGTGGCAGACCCCGTGG + Intergenic
1007809199 6:44474330-44474352 AGGGCTGGTGGCAGACCCCGGGG + Intergenic
1010202948 6:73299064-73299086 GAGGCTGGTGTCAGACCTATTGG + Intronic
1011568625 6:88708560-88708582 AGGGCTGGTGCCAGGCCTTTAGG + Intronic
1012627845 6:101426181-101426203 GGCTCTGGAGCCAGACCTCTGGG + Intronic
1013596249 6:111663432-111663454 GGGTCTGTTGCCAGTCCTCTTGG + Intronic
1017002297 6:150005006-150005028 GGGGCTGGGGCCAAACTTGGCGG - Intergenic
1017011892 6:150068931-150068953 GGGGCGGGGGCCAAACCTGGGGG - Intronic
1017416768 6:154229070-154229092 GGGGCTGGAGGCAGACATGGGGG - Intronic
1018889828 6:167975845-167975867 GGGGCTGGTGTCAGGTCTCGAGG - Intergenic
1019597592 7:1865361-1865383 GGGGCTGGCACCAGGCCTGGGGG - Intronic
1021543353 7:21785141-21785163 GGGTCTTCTGCCAGACCTCTGGG + Intronic
1024430702 7:49285110-49285132 GCTGCTGGGGCCAGAACTCGTGG + Intergenic
1024532544 7:50405768-50405790 GTGGCTGGTCCCACACCTCGAGG - Intergenic
1025249939 7:57344804-57344826 GGGCCTGGTGTGAGACTTCGGGG + Intergenic
1027432032 7:78124322-78124344 GAGGCTGGTGCTAGATCACGGGG + Intronic
1032719148 7:134536673-134536695 GGGGCTGGTGAAAGCCCTTGGGG + Exonic
1032724118 7:134575443-134575465 GGGGCTGGTGAAAGCCCTTGGGG + Exonic
1034595222 7:152183472-152183494 GGGGCTGGGGCCAGGCATGGTGG + Intronic
1041906961 8:63043845-63043867 GGGCCTGGTACTAGACCTCCAGG + Intergenic
1044734819 8:95268786-95268808 GGGGCGGGGGCCAGCCCTCTGGG + Intronic
1047491904 8:125382115-125382137 GGGTCTGGTTCCAGTCCTCCTGG - Intergenic
1048990927 8:139759756-139759778 GGAGCGGGTGCCAGCCCTCCTGG - Intronic
1049408582 8:142462513-142462535 CAGGCTGGGGCCAGACCTCGAGG + Intronic
1050053970 9:1632571-1632593 GGGGCAGGGGCCAGACCAGGTGG - Intergenic
1052694168 9:31854601-31854623 GGGGCTGGTACCAGGCCTATGGG - Intergenic
1053295045 9:36906691-36906713 GGGGCTGGTGGGAGAGCTTGCGG - Intronic
1056782292 9:89559807-89559829 GGGGGTGCTGCTAGGCCTCGAGG + Intergenic
1058916277 9:109568814-109568836 AGGCCTGGTACCAGACCTCCAGG + Intergenic
1060410075 9:123394457-123394479 GGGGGTGGTGCAAGGCCTTGGGG + Intronic
1060815937 9:126635180-126635202 GGAGCTGGAGTCAGACCTGGTGG - Intronic
1061001260 9:127904325-127904347 GTGGCTGTGGCCAGTCCTCGTGG + Intronic
1061149181 9:128819220-128819242 GGGGCCGGCGCCTGGCCTCGCGG + Intronic
1061472265 9:130835816-130835838 GGGGCTGGTGCCGGGGCTGGGGG - Intronic
1061489995 9:130939386-130939408 GGACCTGGACCCAGACCTCGGGG - Intergenic
1061680743 9:132241404-132241426 GGGGCGGGTCCAAGAGCTCGGGG + Intronic
1061806522 9:133140323-133140345 GGGGCGGGTGCCAGAGGTGGGGG + Intronic
1062036432 9:134384629-134384651 GGGGCAGGGGCCAGAGCTGGAGG + Intronic
1062372885 9:136249248-136249270 GGGGCTCCTGCCAGACCCCTAGG + Intergenic
1188397277 X:29701198-29701220 GGGTCTGGAGCCAGACCACTTGG + Intronic
1190325140 X:49202248-49202270 GGTGCTGGAGCCAGACTTCCTGG - Intergenic
1191161273 X:57331678-57331700 GGAGCTGGTGCCATTCCTCTTGG + Exonic
1193270056 X:79518057-79518079 GTGTCTGGTACCACACCTCGGGG + Intergenic
1200213788 X:154358560-154358582 GGGGCTGGGGCCAGGCCTGGTGG - Exonic
1200829455 Y:7676968-7676990 GGGGCTGGTGGCAGGGCCCGAGG - Intergenic