ID: 903375536

View in Genome Browser
Species Human (GRCh38)
Location 1:22863439-22863461
Sequence CTGGATTCACAAAGGGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903375524_903375536 21 Left 903375524 1:22863395-22863417 CCTTACCCCCTTCTGCTGAGTCA 0: 1
1: 0
2: 0
3: 19
4: 189
Right 903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG 0: 1
1: 1
2: 1
3: 17
4: 250
903375529_903375536 13 Left 903375529 1:22863403-22863425 CCTTCTGCTGAGTCACATGGAAG 0: 1
1: 0
2: 0
3: 18
4: 196
Right 903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG 0: 1
1: 1
2: 1
3: 17
4: 250
903375525_903375536 16 Left 903375525 1:22863400-22863422 CCCCCTTCTGCTGAGTCACATGG 0: 1
1: 0
2: 2
3: 21
4: 200
Right 903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG 0: 1
1: 1
2: 1
3: 17
4: 250
903375528_903375536 14 Left 903375528 1:22863402-22863424 CCCTTCTGCTGAGTCACATGGAA 0: 1
1: 0
2: 0
3: 23
4: 174
Right 903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG 0: 1
1: 1
2: 1
3: 17
4: 250
903375527_903375536 15 Left 903375527 1:22863401-22863423 CCCCTTCTGCTGAGTCACATGGA 0: 1
1: 0
2: 2
3: 21
4: 166
Right 903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG 0: 1
1: 1
2: 1
3: 17
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903375536 Original CRISPR CTGGATTCACAAAGGGACAG GGG Intronic
900485667 1:2921482-2921504 CTGGATGGACAGATGGACAGAGG - Intergenic
900485753 1:2921902-2921924 CTGGATGGACAGATGGACAGAGG - Intergenic
900485761 1:2921944-2921966 CTGGATGGACAGATGGACAGAGG - Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
901063327 1:6483888-6483910 CTGGGTTCACAGAGGGCCAGAGG - Intronic
901345902 1:8542163-8542185 CAGGATTCCCAAAGAGGCAGGGG + Intronic
901419310 1:9139707-9139729 TTGGATACACCAAGGGACACGGG + Intergenic
902176259 1:14653233-14653255 CTGGATGAACAAAGGGTCACAGG + Intronic
902615321 1:17620525-17620547 ATGGATCAACAATGGGACAGTGG + Intronic
903249930 1:22045496-22045518 CTGAATCCACAGAGGCACAGAGG + Intergenic
903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG + Intronic
903799703 1:25957544-25957566 CTAGGCTCACAAAGTGACAGAGG - Intergenic
907528815 1:55072073-55072095 CTGGTCACAAAAAGGGACAGGGG - Intronic
908426005 1:64008128-64008150 CTGGAATTACAAAAGGATAGAGG - Intronic
908811836 1:67989442-67989464 TTGGATTCAGAGAGTGACAGGGG - Intergenic
910175816 1:84429181-84429203 CTGGCTTAAGAAAGGGACACAGG - Intergenic
912221561 1:107683180-107683202 CTAGATTTACAAAGGAACACAGG + Intronic
913254432 1:116941061-116941083 GTGGAAGCACAAAGGGAGAGAGG - Intronic
914927766 1:151903786-151903808 CTGTATCCATAAAAGGACAGTGG - Intronic
916657465 1:166888959-166888981 CTGGATTGAGAAACGGACAATGG - Intergenic
916696183 1:167238971-167238993 CTGGATTCAGAATAGGAAAGGGG - Intronic
917305673 1:173621834-173621856 CAGTATTCAAATAGGGACAGAGG + Intronic
918366169 1:183810141-183810163 ATGAATACTCAAAGGGACAGAGG + Intronic
918867153 1:189916741-189916763 ATGGGTACACAAAGGGGCAGAGG - Intergenic
919998016 1:202771999-202772021 CTGGAATCAATAAGGGAGAGAGG + Intronic
920542429 1:206789379-206789401 ATGGATTCACAAAGGCATAAGGG - Intergenic
922054452 1:222027242-222027264 CTGGACTCACTGAGGGACAAGGG - Intergenic
922243235 1:223770720-223770742 TTGGATTCAAGAAGGCACAGAGG - Intronic
924904585 1:248438846-248438868 CTTACTTCACAAAGGGAAAGGGG - Intergenic
924923302 1:248653202-248653224 CTTACTTCACAAAGGGAAAGGGG + Intergenic
1067185246 10:44021642-44021664 ATGAATTTAGAAAGGGACAGAGG - Intergenic
1067337981 10:45379642-45379664 CTGGATTCAGGAAGGGGCACTGG + Intronic
1068279393 10:54849405-54849427 ATTTATTCACAAAGGAACAGAGG - Intronic
1068685598 10:59867349-59867371 CTGAATTCAAAAAGGGAGGGAGG - Intronic
1069358198 10:67612078-67612100 CTGGATTAACAAAAGTACAGAGG + Intronic
1069395044 10:67978516-67978538 CTGGAGTCACCAAGGGCCTGGGG + Intronic
1069440168 10:68421286-68421308 CTGGGTTTACAAATGGACAGAGG - Intronic
1069866028 10:71503373-71503395 CTGTGTGCACAAATGGACAGGGG - Intronic
1071260874 10:83918019-83918041 CTGGATTCAGGCAAGGACAGAGG - Intergenic
1072968521 10:99995838-99995860 CTGTCTTCAAGAAGGGACAGTGG + Intronic
1073084644 10:100880308-100880330 CTGGATGTGCAAAGGGCCAGGGG - Intergenic
1073705792 10:105982495-105982517 GTGGATTCAGAAATGCACAGGGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1080195629 11:29605261-29605283 CTGGATACACCAAGTCACAGGGG + Intergenic
1080355877 11:31444993-31445015 TTGTATTTACAAAGAGACAGAGG - Intronic
1081007076 11:37757936-37757958 CTAGATTGCCAAAAGGACAGAGG - Intergenic
1084014018 11:66368320-66368342 CTGGGTTAACTCAGGGACAGGGG - Intronic
1084180521 11:67443481-67443503 CAGGATTCAGGAAGTGACAGAGG + Intronic
1084431655 11:69114635-69114657 CTGGGTTCACAAAGGGGCCGAGG - Intergenic
1085816465 11:79742393-79742415 CTGGCTTCACAGAGGGGAAGGGG - Intergenic
1085993815 11:81886217-81886239 CTGGATGACCAAAAGGACAGTGG + Intergenic
1090236786 11:125154273-125154295 CTGGTCTCACAAGAGGACAGTGG - Intergenic
1091182354 11:133618386-133618408 GAGGATTCACAAAGTGACTGAGG + Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1091974352 12:4812538-4812560 CTGTTTTCTCAAAGGGGCAGAGG + Exonic
1092864403 12:12747448-12747470 CTGGATTCCAAAGGGGAAAGTGG - Intronic
1094158864 12:27368619-27368641 CTGGAGTCAGAAAGAGACATAGG + Intronic
1094265738 12:28557538-28557560 CTGTATTCATAAAGAAACAGTGG + Intronic
1095133718 12:38572493-38572515 CTGGATTCACCCAGGGCCTGGGG + Intergenic
1096390903 12:51228361-51228383 CTAGATTCACAGTGGGACACAGG + Intergenic
1097952121 12:65443014-65443036 CTGCCTTCACAAAGGGAAATAGG + Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098650266 12:72957800-72957822 CTGGATTCACCAAAGCATAGAGG - Intergenic
1103262010 12:119595586-119595608 CTGGTTTTACAAAGAGACTGAGG - Intronic
1104098372 12:125582625-125582647 GTAGATTCACAAGGGGACTGTGG - Intronic
1105013542 12:132771989-132772011 GTGGAATCACACAGGGCCAGTGG + Exonic
1106073292 13:26435004-26435026 CTGGACTGTCAAAGGGAGAGTGG + Intergenic
1106861846 13:33918065-33918087 TTGGATTCAGAAAGGTCCAGAGG + Intronic
1107306921 13:39032116-39032138 CAGCACTCACAAAGGCACAGTGG + Intronic
1107418234 13:40221169-40221191 CTGTATTTGAAAAGGGACAGTGG - Intergenic
1109306925 13:60651194-60651216 CTGAATTCAGAAAGGGTAAGAGG + Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1113719816 13:112546703-112546725 CTGGACACAGAAAGTGACAGAGG + Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1118094025 14:62516378-62516400 CTTTTTTAACAAAGGGACAGAGG - Intergenic
1119139077 14:72248861-72248883 CCAGATTCACAAAGGCAAAGTGG - Intronic
1120722708 14:87905664-87905686 GTGGATTCTCAGAGGGAGAGGGG + Intronic
1121667909 14:95686502-95686524 CTGGATCCACAGACGGCCAGGGG - Exonic
1122024095 14:98862294-98862316 CTTGATGAACAAAGGCACAGTGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125401331 15:39306836-39306858 CTTGATTCACAAGTGGACAAAGG - Intergenic
1125920568 15:43523109-43523131 CTGGCTGAACAAAGGGACACAGG + Exonic
1127458253 15:59174774-59174796 CAGGATTCACCAAGGACCAGCGG + Intronic
1127655897 15:61055354-61055376 ATGGCTTCACTAAGGGACCGAGG + Intronic
1127976003 15:63997754-63997776 CTGGAGTCAAAGAGGGGCAGAGG + Intronic
1128094961 15:64947268-64947290 CTGGAGTCAGCAAGGGCCAGGGG - Intronic
1128646034 15:69379638-69379660 CTGGATTCCCAAAGGGAGCCTGG + Intronic
1132283405 15:100640694-100640716 CTGGATTCATAAAGGTAGAGAGG - Intronic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134026048 16:10954814-10954836 CTAGATTCAAACAGGGAAAGAGG - Intronic
1134045526 16:11098335-11098357 GAGGATGCAGAAAGGGACAGGGG + Intronic
1134812178 16:17177105-17177127 CTGCATGCACAAAGGCACTGAGG - Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1138615777 16:58164913-58164935 CTTGATTCAGAAAGCGACTGAGG + Intronic
1138816441 16:60208476-60208498 CTGTATTCTCAAAGGAACACTGG + Intergenic
1138987262 16:62344644-62344666 CTGGATTCACGAAGGAACCAAGG - Intergenic
1139325210 16:66147432-66147454 CTGGAATCCCCAAGGGAGAGTGG + Intergenic
1139371851 16:66473879-66473901 CTTGACTTATAAAGGGACAGAGG - Intronic
1141301615 16:82821410-82821432 CTGAATTCACCAAGGGGCATAGG - Intronic
1141384599 16:83608292-83608314 CAGTTTTCACAAAGGGACAAAGG + Intronic
1142570452 17:870212-870234 CTGGAATCAGAAAGTGACTGGGG - Intronic
1144520986 17:15952044-15952066 CTGAATTCTGAAAAGGACAGTGG + Intronic
1149179100 17:53912729-53912751 CTTGGTTCACAAATGGACAATGG + Intergenic
1149990286 17:61379415-61379437 CTGGATTCCTAAAGGGTCAGAGG - Intronic
1151360770 17:73587425-73587447 CTGGAGTGACCCAGGGACAGAGG - Intronic
1151667840 17:75555853-75555875 GCAGAGTCACAAAGGGACAGGGG + Intronic
1153596603 18:6731740-6731762 CTGTATTTACAAAGAGCCAGAGG + Intronic
1154416250 18:14177525-14177547 CTGGATACAGGAAGGGAAAGAGG + Intergenic
1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG + Intergenic
1156994194 18:43447070-43447092 CTGGAGTCCCAGAGGGTCAGGGG - Intergenic
1157889095 18:51397384-51397406 TTGGATCCAGAAAGAGACAGAGG - Intergenic
1157905341 18:51564534-51564556 CTGCATTCAGATAGGGAAAGAGG - Intergenic
1158197542 18:54905600-54905622 CTGGATTCACAAATATACAATGG - Intronic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160791362 19:925242-925264 CTGGTTTCACAAAGGGGCTCCGG + Intergenic
1162479955 19:10922238-10922260 CTGGCTTCACAGAGGGTCTGCGG - Exonic
1166683970 19:44784173-44784195 CTGGATTCCCAACAGGCCAGGGG + Intronic
1166720447 19:44993094-44993116 CTGGAAACACAGAGGGACAGAGG - Exonic
1167511423 19:49897215-49897237 CTTGATTCCCACGGGGACAGAGG + Intronic
1167673521 19:50870375-50870397 CCTGATTCTCAAAGGGTCAGAGG + Intronic
925179017 2:1804657-1804679 CTGGGTTCACCATGGGACACTGG - Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
926908446 2:17827560-17827582 TTGGAGTAACAAAGGGGCAGAGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928142164 2:28739308-28739330 CAGGATTCACAGGGGGACAAAGG - Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
934578190 2:95416387-95416409 CAGGAATCACAAAGGGACCGGGG - Exonic
934601249 2:95660317-95660339 CAGGAATCACAAAGGGACCGGGG + Intergenic
936142323 2:109950972-109950994 GTGGGTTCATAGAGGGACAGTGG + Intergenic
936179013 2:110248931-110248953 GTGGGTTCATAGAGGGACAGTGG + Intergenic
936202365 2:110420501-110420523 GTGGGTTCATAGAGGGACAGTGG - Intronic
936534620 2:113302484-113302506 CCGGCATCACAAAGGGACCGAGG + Intergenic
937076084 2:119107932-119107954 CTGGATTCAGAAAGTGGCAGTGG + Intergenic
937617678 2:123944826-123944848 CTGGACTCACAGAGGGCCTGGGG + Intergenic
937707658 2:124939929-124939951 CTGGATTCAGAAAGCTGCAGTGG - Intergenic
938649461 2:133367269-133367291 CTGTTTTCACAAAGCCACAGCGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939287960 2:140156898-140156920 TTGGAGACAAAAAGGGACAGAGG - Intergenic
940284385 2:152019084-152019106 TTGCATTCACAATGGCACAGTGG + Intronic
940437286 2:153669728-153669750 CAGGAAGCACAAGGGGACAGGGG + Intergenic
944715091 2:202370050-202370072 CTGGTTTTAAGAAGGGACAGAGG - Intergenic
945177847 2:207061709-207061731 CTGGGTTCAGAAGGGCACAGTGG + Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946487205 2:220112315-220112337 GTGGATTTACAAAGTGACTGAGG - Intergenic
946944163 2:224802581-224802603 CTGGAAGCACAGAGGCACAGAGG - Intronic
947434846 2:230064436-230064458 CTGCATTGTCAAAGGGCCAGTGG + Intronic
1170300540 20:14879854-14879876 CTGGGTTTCCAAATGGACAGAGG + Intronic
1171284264 20:23924466-23924488 CTGGATTCACAGTGGGTGAGAGG - Intergenic
1173098993 20:40065893-40065915 CTGGACTCACGAGGGGACAAGGG + Intergenic
1174428457 20:50449974-50449996 CTGGATTCCCAGAGGAGCAGAGG - Intergenic
1174570178 20:51495845-51495867 CAGGTTTCCCACAGGGACAGAGG - Intronic
1174645402 20:52081038-52081060 CTGCATTTAAAGAGGGACAGGGG + Intronic
1175782240 20:61690081-61690103 GTGGATTCTGACAGGGACAGTGG + Intronic
1175856738 20:62124790-62124812 CAGCATGCACAGAGGGACAGTGG - Intronic
1176857095 21:13981772-13981794 CTGGATACAGGAAGGGAAAGAGG - Intergenic
1176867507 21:14062455-14062477 CTGGATACAGGAAGGGAAAGAGG + Intergenic
1177189581 21:17835387-17835409 CTGGCAACACAAAGGGGCAGAGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178499476 21:33113966-33113988 ATGGATTCTCAAAGGAACTGAGG + Intergenic
1179055481 21:37928110-37928132 CTGGGCTCACAAGGGTACAGTGG - Intergenic
1179151664 21:38814351-38814373 GTGGCTTCAAAAAGGAACAGCGG + Exonic
1179277316 21:39904235-39904257 ATGGAGCCACAAAGGGCCAGGGG - Intronic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1184806414 22:46797352-46797374 CAGCATTCACAAAGGGACAGTGG + Intronic
1185202511 22:49516891-49516913 TTGGATTCAGAAATGGACTGGGG - Intronic
951277526 3:20706784-20706806 CTGGCTTCTTAAAGAGACAGGGG + Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953173658 3:40529883-40529905 CTGGATGGACAAAGGAACAAAGG - Intronic
955611715 3:60764439-60764461 CTGCATTAACAATGGAACAGTGG + Intronic
955888991 3:63630812-63630834 CAGCATTTACAAAGGCACAGAGG - Intergenic
958678943 3:97300703-97300725 CTGGCCTATCAAAGGGACAGGGG + Intronic
959303933 3:104635963-104635985 CTGGATTTACCATGGGCCAGAGG + Intergenic
960235348 3:115275307-115275329 GGGGATTTAGAAAGGGACAGGGG + Intergenic
961012673 3:123446996-123447018 CTGGATTAACAAAGCAGCAGTGG + Intronic
961037867 3:123655283-123655305 CTGGAGTCTCAAAGAAACAGGGG - Intronic
961632673 3:128312721-128312743 CTGGATTGGCAAAGGGACCTGGG + Intronic
961697207 3:128713763-128713785 CAGGATTCAGAAAGGAACTGAGG - Intergenic
962473670 3:135737196-135737218 CAGAATTCACCATGGGACAGAGG + Intergenic
965273774 3:166653756-166653778 CTGGACTCACCCAGGGACTGGGG + Intergenic
970023839 4:11599443-11599465 CTGGCTTCACAAGCAGACAGAGG + Intergenic
972956768 4:44402079-44402101 CTGAATTCACAAAGGTAAAGTGG + Intronic
973775881 4:54240694-54240716 CTTGTTAGACAAAGGGACAGTGG + Intronic
975725565 4:77288259-77288281 CAGGATTCAGAAAGCTACAGTGG + Intronic
975755548 4:77568103-77568125 CTGGTAACACAAAGGGACAATGG + Intronic
976682778 4:87775677-87775699 CAGGAATCAGAAAGGTACAGAGG + Intergenic
976951820 4:90842512-90842534 CTGGAGTCAGAAAGGGAAGGAGG + Intronic
977712221 4:100139497-100139519 ATGGATGCACAAAGATACAGTGG - Intergenic
979543537 4:121914242-121914264 CTGAATTAACAAAGGGCTAGGGG + Intronic
981723563 4:147825144-147825166 TTGGATTTAAAAAGTGACAGAGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
984510121 4:180669058-180669080 CTGGAGTAACAAAGGATCAGAGG - Intergenic
984823157 4:183901757-183901779 CTAGATTCAAAAATGGACAAAGG - Intronic
984834567 4:184007792-184007814 CTGGAGACAGAAAGGCACAGAGG - Intronic
986156471 5:5181767-5181789 CAGGAATGAGAAAGGGACAGAGG - Intronic
988731771 5:33979725-33979747 CTTGAATTCCAAAGGGACAGAGG + Intronic
989498889 5:42142401-42142423 CTGGATACAGAAAGAGAAAGAGG + Intergenic
989557338 5:42813038-42813060 CTGGATTCTCAAAGAGATATGGG - Intronic
990230330 5:53706114-53706136 CAGGAAGCACAAAGGGTCAGAGG - Intergenic
992531705 5:77658907-77658929 CTGGACTCACACAGGACCAGGGG - Intergenic
994202470 5:96993586-96993608 CTTTCTTCACTAAGGGACAGTGG + Intronic
995418695 5:111938069-111938091 CTGGATGGACACAGGGCCAGAGG - Intronic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997623340 5:135314861-135314883 CTGGGTTCAAAAAGGGAGAGAGG - Intronic
997722094 5:136087445-136087467 GTAGACTCACAAAGGGGCAGAGG + Intergenic
998903650 5:146880620-146880642 CTTGATTCAGAAAGATACAGGGG - Intronic
999687499 5:154116121-154116143 CTGGATTCACTCAGAGAGAGAGG + Intronic
1000372239 5:160548087-160548109 CAGGATTCCCAAAGTAACAGTGG + Intergenic
1001170285 5:169413117-169413139 CTTGTTTCTCAAAGGGAAAGAGG - Intergenic
1002953261 6:1837261-1837283 CTGTATTTACAAAAGGGCAGGGG + Intronic
1004753005 6:18583103-18583125 GTGGATTCAAAAAGGGACCATGG + Intergenic
1006511052 6:34521387-34521409 CTGGCTTGAGGAAGGGACAGAGG - Intronic
1006936183 6:37720238-37720260 CTGGATTCACCCAGGCACAGGGG + Intergenic
1007605560 6:43115630-43115652 CTGCCTTCAGAAAGGGGCAGTGG + Intronic
1007882391 6:45181977-45181999 TTGTATTCTCAAAGGCACAGTGG + Intronic
1010652690 6:78473567-78473589 CTGGAGTCAGAAATGTACAGAGG + Intergenic
1012034142 6:94110050-94110072 CTGGATTCAGAAAGCTGCAGTGG + Intergenic
1012827304 6:104162711-104162733 CTAGACACACATAGGGACAGAGG + Intergenic
1013925553 6:115467888-115467910 CTGGATCCACACAGGGCCTGGGG - Intergenic
1015082609 6:129246453-129246475 GTGAACTCACAAAGGCACAGTGG - Intronic
1015967735 6:138711855-138711877 CGGGAAGCACAAAGGGTCAGGGG - Intergenic
1018218609 6:161555738-161555760 GTGGATGCACAAAAGGATAGAGG - Intronic
1018885120 6:167928689-167928711 ATGGATGCACAAATGGGCAGAGG - Intronic
1021543235 7:21783764-21783786 CTGGATCCACAAGAGGAGAGTGG + Intronic
1022702878 7:32777961-32777983 CTGCAGTCACAGAGGGATAGTGG + Intergenic
1022748610 7:33200504-33200526 TTGGATTCATAAAAGGACACTGG - Intronic
1023451649 7:40292251-40292273 GTGGATTTTCATAGGGACAGGGG + Intronic
1023929803 7:44698365-44698387 CAGGATGGAGAAAGGGACAGAGG - Intronic
1024964232 7:55007387-55007409 CTTGTTTCACAAAGAGACAAAGG - Intergenic
1025246210 7:57319471-57319493 CTGGATTCCCAGAGGAGCAGAGG + Intergenic
1030396559 7:108994057-108994079 CTTCATTCACCAAGTGACAGAGG - Intergenic
1032425333 7:131818270-131818292 CAGGTTTCAGAAAGGGACAATGG + Intergenic
1032492238 7:132332339-132332361 CAGTAGTCACAAAAGGACAGTGG - Intronic
1032742220 7:134750228-134750250 CTGGATGGAGGAAGGGACAGGGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034377575 7:150659499-150659521 CTTGGTTCCCAAAGGGAAAGGGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035078298 7:156195522-156195544 CTGTATTCAGAAACTGACAGGGG + Intergenic
1035460815 7:159037388-159037410 CTGTTCACACAAAGGGACAGAGG - Intronic
1036008281 8:4692150-4692172 CTGGTTTCCAGAAGGGACAGGGG - Intronic
1037510011 8:19573314-19573336 CTGGATTTTTAAAGGGCCAGAGG - Intronic
1038973950 8:32670754-32670776 CTGTTTTAACCAAGGGACAGTGG + Intronic
1040117538 8:43640803-43640825 TAGAATTCACAAAGGGACATTGG + Intergenic
1042639942 8:70922681-70922703 CAGGATGCTCACAGGGACAGAGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045456587 8:102386101-102386123 CTGGCTTCAAAAATGAACAGTGG + Intronic
1047941114 8:129828069-129828091 CTTGATACACAAAGGGCAAGAGG + Intergenic
1049374887 8:142284659-142284681 CTGGGTCCAGAAAGGGCCAGGGG + Intronic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1049630153 8:143649629-143649651 CAGGATTCACTAATGGTCAGAGG + Intronic
1050680913 9:8110366-8110388 CTGGAATGACAAAGTGGCAGAGG + Intergenic
1051262339 9:15276733-15276755 CTGGACTCACCTAGGGTCAGAGG - Intronic
1051334962 9:16057803-16057825 CTGGATCCACTCAGGCACAGTGG + Intronic
1053564956 9:39239697-39239719 CTGAATTCACAGAAGTACAGAGG + Intronic
1054132194 9:61379342-61379364 CTGAATTCACAGAAGTACAGAGG - Intergenic
1055428411 9:76218952-76218974 CTTCAGTCACCAAGGGACAGAGG + Intronic
1055908997 9:81326244-81326266 CTGGTTTCACTTAGGCACAGTGG + Intergenic
1058713191 9:107698763-107698785 CTGGAATCACAAAGAGACATGGG - Intergenic
1058875905 9:109244647-109244669 CTGTACTCACAAACGGACTGAGG + Intronic
1062044421 9:134418466-134418488 CTGGGCCCACAGAGGGACAGAGG - Intronic
1062333598 9:136055294-136055316 CAGGATTCACACAAGGACACAGG + Intronic
1187107544 X:16259820-16259842 CTGGAACCTCAAAAGGACAGAGG + Intergenic
1187132847 X:16518841-16518863 CTGGACCCACCCAGGGACAGGGG + Intergenic
1187489475 X:19737385-19737407 CTGGAATCACAGAGTTACAGAGG - Intronic
1189845273 X:45130661-45130683 CTGTGTTTATAAAGGGACAGAGG - Intergenic
1194362800 X:92975580-92975602 CTGAATTCACAAAAGGTAAGTGG - Intergenic
1195319915 X:103713375-103713397 CTGGATTCATAAGGGCGCAGTGG - Intronic
1196338487 X:114567809-114567831 CTGCAGTCAGAAAGGAACAGTGG - Intergenic
1196545804 X:116962849-116962871 CTGGAAGCACAAGGGGTCAGGGG - Intergenic
1199009021 X:142737327-142737349 ATGTAGACACAAAGGGACAGAGG + Intergenic