ID: 903377451

View in Genome Browser
Species Human (GRCh38)
Location 1:22875831-22875853
Sequence AGTTCAGGAGGGCATCTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903377451 Original CRISPR AGTTCAGGAGGGCATCTCGG AGG Intronic
900132296 1:1092270-1092292 AGGCCAGGAGGCCAGCTCGGGGG - Intronic
900137829 1:1125885-1125907 AGCCCAGGAGAGCAGCTCGGGGG + Intergenic
902135566 1:14301842-14301864 AGTCAAGGAAGGCCTCTCGGAGG - Intergenic
903047025 1:20572425-20572447 AGTTAAGGAGGGCCTCTTGGAGG + Intergenic
903377451 1:22875831-22875853 AGTTCAGGAGGGCATCTCGGAGG + Intronic
904382521 1:30120945-30120967 AGGCCAGGAGGGCATCCCTGAGG + Intergenic
907359029 1:53899964-53899986 GCTTCAGGAGGGCAGCTCAGAGG - Intronic
915854042 1:159362074-159362096 AGATTAGGAGGACATCTTGGGGG - Intergenic
917620731 1:176793212-176793234 AGTCCTGGAGGGGATCTTGGAGG + Intronic
920428481 1:205898176-205898198 AGTACAGGAGGGCAACATGGAGG - Intergenic
921035754 1:211376674-211376696 AGTTTAGGAAGGCATCCCAGAGG - Intergenic
922164123 1:223100786-223100808 ACTTCAGGAGGGACTCTCTGTGG - Intergenic
922767326 1:228162855-228162877 AGTCCAGGAAGGCTTCTTGGAGG + Intergenic
1063129710 10:3167825-3167847 AGTTTAGGATGGGTTCTCGGTGG + Intronic
1063298331 10:4828178-4828200 AGGTCAGGAGAGCAGCTCTGTGG + Intronic
1063829221 10:9932949-9932971 ATGTCAGGAGGGCTTCCCGGAGG + Intergenic
1065699431 10:28410528-28410550 AGGTCAGGGAGGCATCTCAGGGG - Intergenic
1066003154 10:31123374-31123396 AATTCAGTAAGGCATCTCAGGGG + Intergenic
1067277165 10:44846078-44846100 GTTTGAGGAGGGCATCTGGGAGG - Intergenic
1068994423 10:63186281-63186303 AGTTCAGGAGATCAGCTTGGTGG + Exonic
1069232516 10:66029274-66029296 ATTTCAGGGGAGCATTTCGGGGG - Intronic
1069652473 10:70059796-70059818 AGTTCAAGGGGGCATCAAGGTGG - Intronic
1069660801 10:70122253-70122275 ATTCCATGAGGGCATCTTGGAGG - Intronic
1072417122 10:95258218-95258240 AATTCAAGATGGGATCTCGGCGG + Intronic
1073318694 10:102600615-102600637 AGTTAGGGAGGGCATCTTGGAGG + Intronic
1073340058 10:102737569-102737591 AAATCAGGAGGGCTTCTTGGAGG + Intronic
1074445962 10:113520992-113521014 GAGTCAGGAGGGCATCTCTGAGG - Intergenic
1075408648 10:122211377-122211399 GGTTCAGCAGGGGATCTGGGAGG - Exonic
1079124615 11:17709694-17709716 AGTCCAGGAGAGCTTCACGGAGG + Intergenic
1079262471 11:18896998-18897020 AGTTCTGGATGGCATCTAGTGGG - Intergenic
1080040020 11:27749783-27749805 AGTTGGGGAAGGCATCTCTGAGG - Intergenic
1083519625 11:63296271-63296293 AGTCCAGGAGGGCAGCATGGAGG - Intronic
1084579011 11:70010812-70010834 GGTTGAGGAAGGCATCTCTGAGG - Intergenic
1084579053 11:70011085-70011107 AGTACAGGAGGGCCTCCTGGAGG + Intergenic
1084981720 11:72832489-72832511 AGTTCAGAGGGGCATGTCAGCGG + Intronic
1085313191 11:75528191-75528213 AGTTCAGGAAGGCTTCTCGGAGG - Intergenic
1086856076 11:91867769-91867791 AATCCTGGAGGGCATCTGGGTGG - Intergenic
1087590178 11:100177264-100177286 AGTTAGGGAAGGCATCTCAGAGG - Intronic
1087812387 11:102622533-102622555 AGTCCAGGAAGTCCTCTCGGAGG - Intronic
1089634221 11:119802035-119802057 AGTTCAGGAGGGCTTCCTGGAGG + Intergenic
1089690422 11:120183700-120183722 AATCCAGGAGGGCCTCTTGGAGG - Intronic
1089955147 11:122563755-122563777 AGTCCAGGAGGGCAGCATGGAGG + Intergenic
1092443528 12:8531137-8531159 GGTTCAGCAGGGCATCCTGGTGG - Intergenic
1096807704 12:54150536-54150558 AAATCAGGAGGGCTTCACGGAGG - Intergenic
1101744335 12:107527090-107527112 AGTCATGGAGGGCATCTCTGAGG - Intronic
1102042768 12:109811144-109811166 AATCCAGGAGGGCTTCTTGGAGG - Intronic
1103038412 12:117675051-117675073 AGTTAAGGATGGCATCTCTGAGG - Intronic
1107459800 13:40591000-40591022 GGTTCTGGAAGGCCTCTCGGAGG + Intronic
1109435229 13:62290992-62291014 AGTTCAGGATGACATCTGGGTGG - Intergenic
1113756510 13:112815357-112815379 GGGTGAGGAAGGCATCTCGGTGG - Intronic
1114433875 14:22686758-22686780 AGTTCTGGCTGGCATCTAGGAGG + Intergenic
1114597790 14:23928714-23928736 ACTTCAGGAGGGCAGATCTGGGG - Intergenic
1117333439 14:54736573-54736595 TGTTCAGGAGGACATCTTGAAGG - Intronic
1117626819 14:57649065-57649087 GGATCAGGAAGGCATCTCTGAGG - Intronic
1120655741 14:87187976-87187998 TGTTCAGGATGGCTTCCCGGAGG + Intergenic
1120724395 14:87921818-87921840 AGTTCAAGATGAGATCTCGGTGG - Intronic
1122187623 14:100013318-100013340 TGGTCAGGAGGGCAACTCGATGG + Intronic
1122747868 14:103910358-103910380 AGTTCAGGAAGGAATCCCAGAGG - Intergenic
1127761899 15:62147542-62147564 AGTTCAGGAGGACATGTACGTGG - Intergenic
1128683313 15:69666789-69666811 AATCCAGGAGGGCATTTTGGAGG + Intergenic
1129178614 15:73857464-73857486 AGCTCAGGAGGGCACCTTGGAGG - Intergenic
1129889915 15:79065271-79065293 AGATCAGGAGGGCTTCCCAGAGG + Intronic
1132466919 16:81769-81791 CATTCAGGAGGGCTTCCCGGAGG - Intronic
1132467026 16:82111-82133 CATTCAGGAGGGCTTCCCGGAGG - Intronic
1132645949 16:999360-999382 AGTTTAGGAGGGCTTCCAGGAGG - Intergenic
1136066236 16:27760864-27760886 AACTCAGGAGGGCTTCTCTGAGG + Intronic
1136141463 16:28291812-28291834 AGTCCAGGAGTGCAGCTGGGAGG - Intergenic
1137696697 16:50466443-50466465 AGATCAGGAGGGCTTCCTGGAGG + Intergenic
1137933001 16:52606367-52606389 AGTCCATGGGGGCATCTCAGAGG - Intergenic
1138533873 16:57649472-57649494 AGTTGAGGAGGGCTTCCTGGAGG + Intronic
1139691538 16:68645145-68645167 AGCGCAGGAGGGCATCCGGGAGG + Exonic
1140468129 16:75198299-75198321 AGTCCTGGAGGGAATCTGGGTGG + Intergenic
1140761806 16:78115953-78115975 AGTAGAGGAGGGCATCAAGGGGG - Intronic
1141611056 16:85181435-85181457 AGTTCAGGGGTGCTTCTGGGAGG + Intronic
1143035611 17:3994791-3994813 GGTTCATGGGGGCATCTTGGAGG - Intergenic
1146172298 17:30643483-30643505 AGTTAAGGAGGGCACCTCAAAGG + Intergenic
1146345752 17:32059504-32059526 AGTTAAGGAGGGCACCTCAGAGG + Intergenic
1147242404 17:39099157-39099179 GGATCAGGAGGAAATCTCGGTGG - Intronic
1148746520 17:49921203-49921225 AATTCAGGAGGGCTTCTTGGAGG + Intergenic
1151366716 17:73622387-73622409 AGTTCAGGAGGGACTCACAGAGG - Intronic
1152310571 17:79547534-79547556 GGTTCAGGAGGGCTTGTCTGGGG - Intergenic
1155080158 18:22401388-22401410 AGATCAGGTGGGCAGCTCTGCGG + Intergenic
1157185373 18:45536097-45536119 TGTCCAGGAGGGCTTCTTGGAGG + Intronic
1157281139 18:46347088-46347110 AAATCAGGAGGGCCTCCCGGAGG + Intronic
1161000262 19:1907304-1907326 AATCCAGGAGGGCTCCTCGGAGG - Intronic
1161258738 19:3323828-3323850 AGTCCAGGAGGGCTTCCTGGAGG - Intergenic
1161703919 19:5809103-5809125 AGTCAAGGAGGGCTTCTCAGAGG - Intergenic
1162911263 19:13849037-13849059 AGGTGAGGAGGGCTTCTCGGAGG - Intergenic
1162990127 19:14296562-14296584 AGTTAAGGCGGGCACCTCAGAGG - Intergenic
1163597713 19:18230035-18230057 AGTCAGGGAGGGCTTCTCGGAGG - Intronic
1164589654 19:29499698-29499720 CGTTCAGGAGGGCATCCCTGCGG + Intergenic
1165130319 19:33628056-33628078 AGGTTAGGAGGACTTCTCGGAGG + Intronic
1166668817 19:44697827-44697849 AGTCCAGGAGGGCTTCCTGGAGG + Intergenic
1166939048 19:46351889-46351911 AGTAAAGGAGGGCTTCCCGGAGG + Intronic
1167660097 19:50791346-50791368 AGTTTAGGAGGGCAGCTTGGAGG - Intronic
1167695410 19:51012844-51012866 AATTCAGGAAGGCCTCCCGGAGG + Exonic
1168433034 19:56296216-56296238 AATCCAGCAGGGCTTCTCGGAGG + Intronic
1168583006 19:57570827-57570849 AGTGCAGGAGGACATGTGGGAGG - Intergenic
925627075 2:5852249-5852271 AGGTCAGGAAGGCCTCTCTGAGG + Intergenic
925733661 2:6942139-6942161 AGTCCAGGAGACCATCTCAGAGG + Intronic
925733669 2:6942191-6942213 AGTTCAGGAGACCATCTCAGAGG + Intronic
925842925 2:8009353-8009375 AGATCAGGAGGACGTTTCGGTGG - Intergenic
926126193 2:10273405-10273427 AGCTCAGGAAGGCTTGTCGGGGG - Intergenic
926857661 2:17274350-17274372 AGGGATGGAGGGCATCTCGGTGG - Intergenic
927337399 2:21941104-21941126 AGTTCAAGATGACATCTGGGTGG - Intergenic
928222086 2:29412284-29412306 AATTCAGGAAGGCATCTTGGAGG + Intronic
932050770 2:68395785-68395807 AGTTCGGGAGGCCATCTGGATGG - Exonic
934746387 2:96762157-96762179 AGTCCAGGATGGCATCGCTGCGG - Exonic
935367100 2:102306127-102306149 AGATCAGGGGGCCATCTTGGAGG + Intergenic
938207870 2:129439257-129439279 AGTCCAGGAAGGCTTCTTGGAGG + Intergenic
938649530 2:133367981-133368003 AGTTCTGGGGGGCATCTGGCTGG - Intronic
940055819 2:149511679-149511701 AGCTCAGGAGGGCATCCATGTGG - Intergenic
947349319 2:229225950-229225972 AGTTCAGGATGACATCTGGTTGG + Intronic
1169538944 20:6579398-6579420 AGTTCAACTGGGCATCTCTGGGG - Intergenic
1170643491 20:18176535-18176557 GGTTCAGGACGGCCTCTCTGAGG + Intronic
1171454464 20:25259711-25259733 AGCTCCGGAGGTCATCTCAGGGG - Intronic
1172442867 20:34978128-34978150 AGTCCATAAGGGCATCTCTGTGG - Intronic
1172775792 20:37406101-37406123 AGGTCAGGGTGGCATCTGGGTGG + Intergenic
1173250378 20:41361315-41361337 AGTCCAGTAGGTCATCCCGGAGG + Exonic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173715521 20:45200159-45200181 AGTTCAGGAGGGCAGTGCAGAGG - Intergenic
1174617013 20:51843467-51843489 GGTCCAGGAGGGCTTCTCTGAGG + Intergenic
1174696223 20:52561281-52561303 AGTCCAGGAGGGCAGCATGGAGG - Intergenic
1175534854 20:59702450-59702472 GGGTCAGGAGGGCATCTTAGAGG - Intronic
1179892848 21:44345629-44345651 AGTTCCCAAGGGCATCTGGGAGG - Intergenic
1180600492 22:17012286-17012308 ACATCAGGAGGGCTTCTTGGAGG + Intergenic
1180963573 22:19773873-19773895 ACTGCAGGAGGGAAACTCGGCGG - Intronic
1181455980 22:23060555-23060577 GGTTGAGGAGGGCATCTCTCAGG - Intronic
1181728026 22:24825079-24825101 AGTCCAGGAAGGCTTCTAGGAGG + Intronic
1184263062 22:43330373-43330395 AATTCAGGAGGGCTTCTTAGAGG - Intronic
1185034377 22:48463964-48463986 AGTGTAGGAGGGCATCTTTGTGG - Intergenic
1185253048 22:49815782-49815804 AGCTCGGGAGGGCACCTGGGTGG - Intronic
949772397 3:7593552-7593574 TGGTCAGGAGGGCTTCTTGGAGG + Intronic
952812366 3:37415869-37415891 AGTTCAACAGGGCTTCTCAGAGG - Intronic
954202217 3:49030475-49030497 AATTCAGGAGGCCATCGCAGTGG - Exonic
955345735 3:58160572-58160594 AGTTCAGGAGGGCTTCTCAGAGG + Intronic
955353967 3:58215272-58215294 AGGCCAGGAGGGCTTCTCTGAGG - Intergenic
956327413 3:68069485-68069507 AGTTCAAGAGGACATTTGGGTGG + Intronic
959613609 3:108322398-108322420 AGTGCAGGAGAGAATCTAGGGGG + Intronic
963140180 3:141940473-141940495 CTTTCAGGAGAGCATCTCAGTGG - Intergenic
967086697 3:186101592-186101614 TGTTCAGGAAAGCATCTGGGAGG - Intronic
969176496 4:5402852-5402874 AGTGCAGGAGGGCTTCCTGGAGG + Intronic
969674824 4:8608710-8608732 ACTTCAGGAGGGCTTCCCTGAGG + Intronic
979515439 4:121603869-121603891 AGATCAGGGGGGCATTTAGGAGG - Intergenic
980096866 4:128500828-128500850 AGTCCAGGAGGGCAGCACGCAGG + Intergenic
980467710 4:133206391-133206413 AGTTGATGAGGACATCTGGGAGG + Intronic
980798406 4:137714980-137715002 AGGCCACGAGGGCATCTTGGAGG - Intergenic
981148933 4:141358779-141358801 ACTTCAGGAGGCCAAGTCGGGGG - Intergenic
981688831 4:147483493-147483515 AGTTCAGGGGGAAATCTCTGGGG + Intronic
985662298 5:1163363-1163385 AGTGCTGGAGGGGCTCTCGGTGG + Intergenic
985669551 5:1200520-1200542 AGTTCAGGAGAGGATCCTGGGGG - Intergenic
986360755 5:6975780-6975802 AGCTCATGAGGGCAGCTGGGGGG + Intergenic
986755611 5:10833152-10833174 AGTTCGAAAGGGCATCTCTGGGG - Intergenic
997436632 5:133880394-133880416 AGTCCAGGAGGGCTTCCTGGAGG - Intergenic
997437363 5:133885170-133885192 AGCTGAGGAGGCCATCTTGGAGG - Intergenic
998730000 5:145064010-145064032 AGTTCTGGAGGGCAGCTAGTGGG - Intergenic
998795382 5:145812710-145812732 AGTACAGGAGGGCTTCCCTGAGG + Intronic
999101658 5:149030354-149030376 AGATCAGGAGTGCAGCTCTGCGG - Intronic
999432959 5:151539922-151539944 AGTGAAGAAGGGCATCTCAGTGG + Intronic
999757527 5:154676058-154676080 AGATCATGAGGCCATCTTGGGGG - Intergenic
1003077801 6:2998578-2998600 GGGGCAAGAGGGCATCTCGGAGG + Intronic
1003085357 6:3056041-3056063 GGGGCAAGAGGGCATCTCGGAGG - Intergenic
1007249560 6:40486504-40486526 ATGGCAGGAGGGCATCTCAGCGG + Intronic
1007473968 6:42107064-42107086 GGCTCAGCAGGGCTTCTCGGGGG + Exonic
1009289383 6:61865571-61865593 AATTCAAGATGGCATCTGGGTGG + Intronic
1009838859 6:69041076-69041098 AGCTTAGGAGGGCATCTCCAAGG - Intronic
1017232634 6:152089906-152089928 AGTTCAGTAGGGCATTTGAGAGG + Intronic
1017484437 6:154889865-154889887 AGTTGAGGAGGGCAGGTCTGAGG - Intronic
1019505494 7:1388487-1388509 AGTCAAGGAAGGCTTCTCGGAGG + Intergenic
1019698239 7:2459897-2459919 AGCTGAGGAAGGCATTTCGGAGG + Intergenic
1021529280 7:21625142-21625164 AGGACAGGAGGGCTTCACGGTGG - Intronic
1023792991 7:43768754-43768776 TGTTGGGGAGGGCATCTCTGTGG + Intronic
1025198061 7:56947244-56947266 CGTCCAGGGGAGCATCTCGGGGG - Intergenic
1025673888 7:63629693-63629715 CGTCCAGGGGAGCATCTCGGGGG + Intergenic
1026897604 7:74019334-74019356 AGTCCAGGAGGGCTTCCTGGAGG - Intergenic
1027716784 7:81681667-81681689 AGTTTAGGAGGGCTTCCCAGAGG + Intergenic
1028760133 7:94486872-94486894 AGTTGAGGATGGCATCACAGAGG - Intergenic
1029624633 7:101712847-101712869 AGTTCAGGAGGACATCCTGGAGG + Intergenic
1032797931 7:135292396-135292418 AGATCTGGAGGGCCTCTGGGAGG + Intergenic
1034244751 7:149635905-149635927 GGTGCAGGCGGGCATCTCGTTGG - Intergenic
1034261093 7:149756109-149756131 AGATCAGGAGGGCATCTCTGAGG - Intergenic
1035413032 7:158660761-158660783 AATTCAGGAGGACATTTGGGTGG - Intronic
1035490409 7:159271487-159271509 AGTCCAGGAGGGCAGTTTGGAGG - Intergenic
1044564676 8:93649964-93649986 TGTTCAGAAGGGCATCTAGCTGG + Intergenic
1044699695 8:94954564-94954586 TGGTCAGGAGGGCCTCTCTGAGG + Intronic
1050823431 9:9913561-9913583 AATTCAGGAGGGCAGCACAGAGG + Intronic
1052325821 9:27215871-27215893 AGTTAAGGAGGGCTTCCTGGAGG + Intronic
1053009517 9:34625213-34625235 GGTCCAGGAGGGCATCAGGGTGG - Intronic
1053061489 9:35035836-35035858 GGCCCAGGATGGCATCTCGGAGG - Intergenic
1053350001 9:37407541-37407563 AGATCAGGAGTGGATCTCTGGGG - Intergenic
1057243485 9:93433977-93433999 AGCTCAGTAGAGCATCTGGGAGG + Intergenic
1058254341 9:102742696-102742718 AGATCAGGAGGGAATCTATGTGG + Intergenic
1058840425 9:108902248-108902270 GGTCCAGGAAGGCCTCTCGGAGG - Intronic
1058935326 9:109764486-109764508 GGTCCAGGAAGGCATCTCAGAGG - Intronic
1059521987 9:114951407-114951429 AGTCCAGGAAGGCATCTCAGAGG + Intergenic
1061301864 9:129710087-129710109 GGTCCAGGAGGGCTTCTTGGAGG + Intronic
1061653975 9:132073667-132073689 AGTTCAGGAGGGCAGGAGGGAGG + Intronic
1062377217 9:136267637-136267659 AGTCCGAGAGGGCTTCTCGGAGG - Intergenic
1192193113 X:69007507-69007529 ATTTCAGGAGGGCTTTTTGGAGG + Intergenic
1194696220 X:97054513-97054535 AGTTCAGGAAGGCATCTCAAAGG + Intronic