ID: 903384796

View in Genome Browser
Species Human (GRCh38)
Location 1:22919273-22919295
Sequence CAGATTAGGACCCATGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903384791_903384796 -9 Left 903384791 1:22919259-22919281 CCCAAACCCAGACGCAGATTAGG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 903384796 1:22919273-22919295 CAGATTAGGACCCATGAAGTAGG 0: 1
1: 0
2: 0
3: 4
4: 92
903384793_903384796 -10 Left 903384793 1:22919260-22919282 CCAAACCCAGACGCAGATTAGGA 0: 1
1: 0
2: 2
3: 4
4: 99
Right 903384796 1:22919273-22919295 CAGATTAGGACCCATGAAGTAGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903384796 Original CRISPR CAGATTAGGACCCATGAAGT AGG Intergenic
903384796 1:22919273-22919295 CAGATTAGGACCCATGAAGTAGG + Intergenic
910480676 1:87655175-87655197 CACATAAGGACACAGGAAGTAGG + Intergenic
910607215 1:89100196-89100218 CAGATGAGGACACAGTAAGTAGG + Intergenic
910857571 1:91710942-91710964 CAGATTAACACACATGAAGCTGG + Intronic
915669453 1:157476606-157476628 CTGACTTGAACCCATGAAGTTGG + Intergenic
917076341 1:171209127-171209149 CTGACTAGGACCATTGAAGTTGG - Exonic
1073810424 10:107146699-107146721 CAGTTTAGACCCCATGCAGTTGG - Intronic
1073991688 10:109268746-109268768 CAGAATAAGACCCATGATGCAGG + Intergenic
1076459021 10:130625862-130625884 AAGATTAGAACCCAGGATGTTGG + Intergenic
1080586488 11:33687559-33687581 CATATGAGGACTCATGAAGAAGG + Intergenic
1092365894 12:7876725-7876747 GAGCTTAGGTCCCATTAAGTTGG - Intronic
1103996199 12:124831748-124831770 AAGAATAGGACCCATGCAGCAGG + Intronic
1105937824 13:25118188-25118210 CAGCTAGGAACCCATGAAGTTGG + Intergenic
1106222536 13:27758518-27758540 CAGGTTAGTACCCATGACTTTGG + Intergenic
1107428586 13:40318094-40318116 CAAATAAGCACACATGAAGTTGG - Intergenic
1114190001 14:20433649-20433671 CAGATTCGCAACCATTAAGTAGG + Intronic
1114282780 14:21209499-21209521 CAGATTAGAAAACATCAAGTGGG + Intronic
1117068028 14:52030134-52030156 CAGATTTAGAACCAGGAAGTTGG - Intronic
1118728415 14:68649132-68649154 CACATTAGGACACATTAAGATGG + Intronic
1121821951 14:96977300-96977322 AAGATTAGAACCTAGGAAGTTGG + Intergenic
1122567169 14:102667625-102667647 AAGATGAGAAACCATGAAGTTGG + Intronic
1124585313 15:31000240-31000262 CAGATTAGAACTCTTGAACTGGG - Intergenic
1128990333 15:72254395-72254417 CAGAATAGGACACTTGAACTGGG + Intronic
1129025135 15:72564796-72564818 CATATGAGGACCCAGCAAGTAGG - Intronic
1130250190 15:82295037-82295059 CAGGTTAGGACACCTGCAGTAGG - Intergenic
1133322980 16:4925747-4925769 AAGATTCGAACCCATGAAGACGG + Intronic
1133569399 16:7026169-7026191 CAGAGTAGGCCCCAAGAAGTTGG - Intronic
1140358551 16:74325809-74325831 CTGTTCAGAACCCATGAAGTGGG + Intergenic
1141477074 16:84281230-84281252 CTGATTTGGACCAATGAGGTGGG - Intergenic
1143631319 17:8142001-8142023 CGGACCAGGACCCATGAAGCTGG + Intronic
1147513820 17:41097437-41097459 AATATTAGGACACATGGAGTGGG - Exonic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1148998727 17:51735116-51735138 CAGAGTAGCACCCATGCAGAAGG - Intronic
1153380301 18:4431022-4431044 CATGTTAGGAGCCGTGAAGTAGG - Intronic
1158451847 18:57573754-57573776 CAGATGAGGAAACTTGAAGTTGG - Intronic
1159023319 18:63160825-63160847 CAGTTTAGGACCCCTGGAGCAGG - Intronic
1159212006 18:65335906-65335928 CAGATTATGTCCCATAAAGAAGG + Intergenic
926009110 2:9394463-9394485 CAGATTAAGAGCCACGAACTGGG - Intronic
928692250 2:33812063-33812085 CTGATTGGTACCCATGAGGTAGG + Intergenic
932446236 2:71783172-71783194 CAGATTAGCCCTCATGATGTTGG + Intergenic
933207313 2:79521937-79521959 CACATTGGGGCCCATGGAGTTGG + Intronic
937116931 2:119413267-119413289 CAGTTGAGGGCCCAGGAAGTGGG + Intergenic
937637923 2:124177526-124177548 CAGATTAGGACACATGGAAAGGG - Intronic
939941581 2:148358007-148358029 CAGATTAGAACTGCTGAAGTGGG - Intronic
944160971 2:196659266-196659288 CAGATTGGGAAATATGAAGTAGG + Intronic
945541285 2:211090286-211090308 CTGCTTTGGATCCATGAAGTAGG + Intergenic
945902765 2:215557221-215557243 CATATGAGGACCCAGCAAGTAGG + Intergenic
1174158044 20:48529282-48529304 CAGATGAGGACCTATGCTGTTGG + Intergenic
1184061158 22:42082499-42082521 CATATTAGAGCACATGAAGTTGG - Intronic
1184145799 22:42609566-42609588 AAGATTCAGGCCCATGAAGTGGG + Intronic
1185082056 22:48714941-48714963 CAGAGCAGGCCCCATGAAGACGG - Intronic
951244577 3:20325667-20325689 CACATTAGGACACAGCAAGTAGG - Intergenic
958461273 3:94399545-94399567 CATATTAGGACCCAGCAAGAAGG - Intergenic
963583570 3:147156181-147156203 CAGATTAGCAGCCATGAAAAGGG - Intergenic
964392409 3:156211621-156211643 CATATTATGCCCCATGAAGATGG + Intronic
965814589 3:172623742-172623764 AAGACTAGGACCCTTGATGTGGG - Intergenic
967264225 3:187676023-187676045 CAGACAAGGAACCATGAAGAGGG - Intergenic
968163274 3:196444388-196444410 CAGTTTACGAGCCATGAAGCTGG - Intergenic
972836001 4:42870438-42870460 CAGACTAGAACACACGAAGTAGG + Intergenic
983100131 4:163615176-163615198 CAGGTTAGGTCCCAGGAGGTGGG + Intronic
985408993 4:189663780-189663802 CAGATTCAGACCCATGAGGCAGG - Intergenic
989391960 5:40910000-40910022 TGGATTAGGAGCCATGCAGTAGG + Intronic
990522147 5:56590509-56590531 GAGATTAGGATACATGAATTTGG + Intronic
991142020 5:63255545-63255567 CAGTTTAGGAGTCATGCAGTTGG + Intergenic
999682624 5:154074293-154074315 TTGATTAATACCCATGAAGTAGG - Intronic
1001649688 5:173307014-173307036 CAGAAAAGGACACATGTAGTAGG - Intergenic
1002466215 5:179410165-179410187 CACATTAGGGCCCAGGAAGCTGG - Intergenic
1002978599 6:2111397-2111419 AAAATTATGACTCATGAAGTAGG - Intronic
1003137325 6:3443762-3443784 CAGATTTGCACCCAGGAAGCTGG + Intronic
1003235726 6:4293921-4293943 GGGATTAGAACCCATGCAGTGGG - Intergenic
1007731385 6:43949704-43949726 CAGACTTGGCCCCATGAAGGGGG + Intergenic
1011452313 6:87506878-87506900 CAGGTTAGGAGCTATGGAGTAGG + Intronic
1011847924 6:91589884-91589906 CAGATGTGGTCCCTTGAAGTTGG + Intergenic
1012528758 6:100209281-100209303 CAGCATAGGACTCTTGAAGTAGG - Intergenic
1013322267 6:109005722-109005744 CAGATTAGGACTCTTCAATTTGG - Intronic
1013816094 6:114100010-114100032 TAGAATATGAACCATGAAGTTGG - Intronic
1021476534 7:21067709-21067731 CAGAGTTTGACCCATAAAGTTGG + Intergenic
1028770924 7:94620750-94620772 CAGAAAAGGAGCCATGAAGCTGG - Intronic
1037739949 8:21600761-21600783 CAGATCAGGACCCAAGAGGAAGG + Intergenic
1039968403 8:42300250-42300272 CACAGTAGGACCCAGGCAGTAGG + Intronic
1040700405 8:50056553-50056575 CAGATTGGAACCCAAGAAGTTGG - Intronic
1044819806 8:96148222-96148244 CAGGTGAGGCCCCTTGAAGTAGG - Intronic
1045221480 8:100204457-100204479 TTGATTTGGGCCCATGAAGTAGG + Intronic
1045929576 8:107605983-107606005 GACATTAGGACCCAGGAAGAAGG + Intergenic
1050146149 9:2569832-2569854 CAGATTACGCCCCATAATGTGGG + Intergenic
1056985141 9:91356835-91356857 CAAATTAGGATCTTTGAAGTTGG - Intronic
1058004858 9:99903995-99904017 CTGATGACAACCCATGAAGTAGG - Intergenic
1058541410 9:106016009-106016031 AACATTAGCACTCATGAAGTTGG - Intergenic
1058931943 9:109729270-109729292 CACTTTAGGACACATCAAGTTGG - Intronic
1186117986 X:6325282-6325304 CAGATGAGGACACAAGAAGAAGG + Intergenic
1186714071 X:12231801-12231823 TAGAATAGGACTCATGAAGTGGG - Intronic
1187441241 X:19322535-19322557 GAGAATAGAACCCAAGAAGTTGG + Intergenic
1191152944 X:57240772-57240794 CAGTGTAGGAGCTATGAAGTTGG + Intergenic
1195331803 X:103808912-103808934 GAGACTAGGACCCATGAAGAAGG + Intergenic
1197249351 X:124198825-124198847 CAGTTTAGGACCCTGCAAGTTGG + Intronic
1197255301 X:124256757-124256779 AAGAGTAGGACCCATGAGATGGG + Intronic
1199390819 X:147276346-147276368 CAGATTAGGACCTGGGAAGCAGG + Intergenic