ID: 903385366

View in Genome Browser
Species Human (GRCh38)
Location 1:22922725-22922747
Sequence TTGCAGGTTGATCTGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903385361_903385366 9 Left 903385361 1:22922693-22922715 CCTGGGAACACACTTGGGTAATG No data
Right 903385366 1:22922725-22922747 TTGCAGGTTGATCTGGAGCTAGG No data
903385357_903385366 17 Left 903385357 1:22922685-22922707 CCAGTGTCCCTGGGAACACACTT No data
Right 903385366 1:22922725-22922747 TTGCAGGTTGATCTGGAGCTAGG No data
903385360_903385366 10 Left 903385360 1:22922692-22922714 CCCTGGGAACACACTTGGGTAAT No data
Right 903385366 1:22922725-22922747 TTGCAGGTTGATCTGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903385366 Original CRISPR TTGCAGGTTGATCTGGAGCT AGG Intergenic
No off target data available for this crispr