ID: 903389484

View in Genome Browser
Species Human (GRCh38)
Location 1:22953864-22953886
Sequence GCCCGACGTGCGCGCGCGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903389484_903389487 12 Left 903389484 1:22953864-22953886 CCAGGCGCGCGCGCACGTCGGGC 0: 1
1: 0
2: 1
3: 11
4: 92
Right 903389487 1:22953899-22953921 CCCGTGTCTGCCATCCCCAGCGG 0: 1
1: 0
2: 0
3: 20
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903389484 Original CRISPR GCCCGACGTGCGCGCGCGCC TGG (reversed) Exonic