ID: 903389484 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:22953864-22953886 |
| Sequence | GCCCGACGTGCGCGCGCGCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 105 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 11, 4: 92} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 903389484_903389487 | 12 | Left | 903389484 | 1:22953864-22953886 | CCAGGCGCGCGCGCACGTCGGGC | 0: 1 1: 0 2: 1 3: 11 4: 92 |
||
| Right | 903389487 | 1:22953899-22953921 | CCCGTGTCTGCCATCCCCAGCGG | 0: 1 1: 0 2: 0 3: 20 4: 158 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 903389484 | Original CRISPR | GCCCGACGTGCGCGCGCGCC TGG (reversed) | Exonic | ||