ID: 903389926

View in Genome Browser
Species Human (GRCh38)
Location 1:22956415-22956437
Sequence TCACTCCCACACACAGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903389926_903389930 8 Left 903389926 1:22956415-22956437 CCCAGTTCTGTGTGTGGGAGTGA 0: 1
1: 0
2: 5
3: 26
4: 316
Right 903389930 1:22956446-22956468 ACATCCATTGACTGAGACTCAGG 0: 1
1: 0
2: 2
3: 8
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903389926 Original CRISPR TCACTCCCACACACAGAACT GGG (reversed) Intronic
900094717 1:935674-935696 CCACGCTCACACACAGAGCTAGG + Intronic
900541281 1:3204230-3204252 TCACACCCACACACACTACAGGG - Intronic
903389926 1:22956415-22956437 TCACTCCCACACACAGAACTGGG - Intronic
904708000 1:32406216-32406238 CCACTCCTACACACAGCTCTTGG + Intergenic
904998435 1:34649543-34649565 TCTCACACACACACAGAACAGGG + Intergenic
905141746 1:35851477-35851499 CCACTCCCACACACACATCCAGG - Intronic
905505046 1:38471876-38471898 ACACACACACACACAAAACTAGG + Intergenic
905788786 1:40779072-40779094 TCAGTGCCACACCCAGATCTGGG + Intergenic
906524802 1:46487855-46487877 TCAGTCACACACACAGACATGGG - Intergenic
906812930 1:48847813-48847835 TCAGTACCAAACACAGAACCTGG + Intronic
907936253 1:59044850-59044872 ATACTCACACAAACAGAACTAGG - Intergenic
908469084 1:64424363-64424385 TCTTCCCTACACACAGAACTTGG - Intergenic
909391098 1:75123618-75123640 ACACACACGCACACAGAACTTGG - Intergenic
909698113 1:78490548-78490570 TCACTGTCACACAGAGGACTGGG - Intronic
910020833 1:82587453-82587475 TGACTCCCACATACAGATGTTGG - Intergenic
910105965 1:83631436-83631458 ACACACACACACACAGAGCTAGG + Intergenic
910587347 1:88894048-88894070 ACACACACACACACAGAGCTGGG + Intergenic
911179735 1:94849698-94849720 GGACGCCCACACACAAAACTGGG - Intronic
912081151 1:105938029-105938051 TCACACACACACACAGAAATTGG - Intergenic
915019364 1:152764815-152764837 TCACTCCCACCCAGAGGCCTGGG - Intronic
915130142 1:153690153-153690175 ACACACACACACACAGAGCTGGG + Intronic
915150452 1:153826629-153826651 ACACACACACACACACAACTTGG + Intronic
915793230 1:158698116-158698138 ACACACACACACAGAGAACTAGG + Intergenic
916335580 1:163667391-163667413 TCACTCACTCACTCAAAACTGGG - Intergenic
918143555 1:181737442-181737464 TCACTCCCACATACACATATTGG - Intronic
918906368 1:190500534-190500556 ACACGCACACACACAGAAATGGG + Intergenic
919121253 1:193342946-193342968 ACACTCACACACACACAAATGGG - Intergenic
920850545 1:209625341-209625363 TCTCTCCCACAGGCAGCACTGGG + Intronic
920969645 1:210732201-210732223 TCACCCCCACAAGCAGAACCAGG + Intronic
921679668 1:218015551-218015573 ACACATACACACACAGAACTTGG - Intergenic
922481656 1:225943510-225943532 TCATTTCCAGACACAGAACAAGG - Intergenic
923145150 1:231192603-231192625 TCATTCACACACAAAGGACTGGG + Intronic
923915638 1:238500788-238500810 CCACTCCTCCATACAGAACTTGG - Intergenic
1063686922 10:8245892-8245914 ACACTGCTACACACAAAACTAGG - Intergenic
1064686672 10:17868765-17868787 TCACTCCCACTAATAGAAATAGG + Intronic
1067083047 10:43222398-43222420 TCACTCCCACCCCCAGCTCTAGG + Intronic
1070072384 10:73102274-73102296 ACACACACACACACACAACTTGG + Intergenic
1070169014 10:73918591-73918613 TCAGTCCCACACACAGATGATGG - Intronic
1070203847 10:74235665-74235687 TCACTCCCACACAGGAAAATTGG - Intronic
1070339825 10:75487746-75487768 CCACTCACACACTCAGCACTTGG - Intronic
1071007352 10:80897607-80897629 TCAACCCCACATGCAGAACTGGG - Intergenic
1072586497 10:96787395-96787417 TCACCCCCACACAAAGTGCTGGG + Intergenic
1073973386 10:109071378-109071400 ACACACACACACACAGAAGTTGG - Intergenic
1074356757 10:112792525-112792547 TCACCCCTACACACACACCTAGG + Intronic
1075331494 10:121577487-121577509 TCAATCCCTAACACAGAATTGGG + Intronic
1078788432 11:14519965-14519987 CCTCTCCCATACACAGCACTAGG + Intronic
1079146641 11:17858197-17858219 TCTCCCCAACACACATAACTAGG + Intronic
1080179741 11:29411282-29411304 ACACACACACACACAAAACTAGG - Intergenic
1080838555 11:35963412-35963434 ACACACACACACACAGAACTGGG - Intronic
1081565870 11:44260965-44260987 TCACTCACACACATAGAGCTAGG - Exonic
1082910378 11:58366518-58366540 TCACTCCCACAGTCATAGCTGGG - Intergenic
1083990218 11:66242164-66242186 TCACTCCCACGCACAGGAGCCGG - Intronic
1084913671 11:72411614-72411636 TCCCTCCCACAAACAGAGCCTGG - Intronic
1085191300 11:74625866-74625888 ACACACACACACACACAACTAGG - Intronic
1085215036 11:74822004-74822026 TCACTCACACACACACACCCTGG - Intronic
1085700177 11:78738878-78738900 ACACATCCACACACAGAACTAGG - Intronic
1085741664 11:79082637-79082659 TCACTGCATCTCACAGAACTTGG - Intronic
1086460079 11:86997354-86997376 TCCCTCCCCCAAACAAAACTGGG + Intergenic
1086837757 11:91646606-91646628 CCACTCCTACACACAGCACCTGG + Intergenic
1087249183 11:95876870-95876892 TCTCTCACACACACACAATTAGG + Intronic
1087755321 11:102048605-102048627 TCACACCCACTCTGAGAACTGGG + Intronic
1089481324 11:118807421-118807443 TCACTCTGCCACCCAGAACTGGG - Intergenic
1089500030 11:118926265-118926287 ACACACACACACACAGCACTGGG + Intronic
1090972555 11:131655778-131655800 TCATTGCCTCACACAGAGCTTGG - Intronic
1091175507 11:133554196-133554218 TCAATGCCACCCACAAAACTGGG + Intergenic
1091332974 11:134744924-134744946 ACACACACACACACAGAAGTAGG + Intergenic
1091357814 11:134951324-134951346 TGGCTCCCTCACACAGGACTAGG - Intergenic
1091622764 12:2101693-2101715 TCACTGTCACCCACTGAACTGGG - Intronic
1092171715 12:6377517-6377539 TCACTCCCACACAGAGCCCGTGG + Intronic
1093071617 12:14711503-14711525 TTACACACACACACACAACTTGG + Intergenic
1093147862 12:15588428-15588450 TGACTTCAACACATAGAACTAGG + Intronic
1094051848 12:26228660-26228682 ACACACACACACACAGAACATGG + Intronic
1095300075 12:40574170-40574192 TCTCTCTCATACACAAAACTGGG + Intergenic
1095321644 12:40835635-40835657 TCAATCCCACACACAGAATCAGG + Intronic
1095395911 12:41762163-41762185 TTACTCTCAAATACAGAACTGGG - Intergenic
1097158229 12:57028072-57028094 CTACTCCCACACACAGCACAGGG - Intronic
1099497012 12:83360990-83361012 ACACACACACACACATAACTTGG - Intergenic
1100134882 12:91543507-91543529 TCAGTCTGACACACAGAGCTAGG + Intergenic
1100134889 12:91543553-91543575 TCAGGCACACACAGAGAACTGGG + Intergenic
1102217961 12:111175021-111175043 TCCCCCCCACACACAGAAGAGGG + Intronic
1102549847 12:113683849-113683871 CCGCTCCCATCCACAGAACTGGG + Intergenic
1102920085 12:116785242-116785264 ACACACACACACACAGAAGTAGG - Intronic
1103323378 12:120104359-120104381 TCACTTCCAAACACACAAATAGG + Intronic
1103425633 12:120830924-120830946 ACACTCTCACACACAGAAATAGG - Intronic
1104019666 12:124983431-124983453 ACACACACACACACAGAACAAGG + Intronic
1104214860 12:126725669-126725691 TCCCCCCCACACACACACCTAGG - Intergenic
1104670705 12:130678108-130678130 TCCCTCCCACAAACAAACCTGGG + Intronic
1106973732 13:35179475-35179497 TCATTTCCAAAGACAGAACTGGG + Intronic
1108625926 13:52228773-52228795 TCACTCCCAGCCACAGTGCTGGG - Intergenic
1108660140 13:52577707-52577729 TCACTCCCAGCCACAGTGCTGGG + Intergenic
1110851340 13:80248716-80248738 ACACACACACACACAGAGCTGGG + Intergenic
1111296248 13:86281967-86281989 TAACTCTCACACACAGAACTTGG - Intergenic
1112107060 13:96252621-96252643 TCACTCCAACAAACAGCACACGG - Intronic
1112151526 13:96769727-96769749 ACACACACACACACAGAGCTAGG - Intronic
1113883131 13:113639986-113640008 TCAGTCACACAAACAGAACGGGG - Intronic
1116115600 14:40645593-40645615 TCACACCCACACAAAGTACTGGG - Intergenic
1117452700 14:55866073-55866095 TCACTCTGACACACAGAGCTAGG - Intergenic
1118396923 14:65345713-65345735 ACACACACACACACACAACTGGG - Intergenic
1120792467 14:88597783-88597805 TGGATCCCACACACAGATCTCGG - Intronic
1120905930 14:89621258-89621280 GGACCGCCACACACAGAACTGGG - Intergenic
1121331550 14:93052779-93052801 TCAGTCCCTCACTCAGAACTGGG + Intronic
1123389275 15:19853219-19853241 TCTCTCCCCCTCACACAACTGGG - Intergenic
1123501191 15:20882609-20882631 TCCTTCCCATACAGAGAACTGGG - Intergenic
1123558443 15:21456314-21456336 TCCTTCCCATACAGAGAACTGGG - Intergenic
1123594674 15:21893589-21893611 TCCTTCCCATACAGAGAACTGGG - Intergenic
1123936552 15:25196843-25196865 TACCTCCCAAACACAGAGCTGGG - Intergenic
1124504009 15:30256276-30256298 TCAGCCCCACACACAAAACATGG - Intergenic
1124739545 15:32282370-32282392 TCAGCCCCACACACAAAACATGG + Intergenic
1127621704 15:60740392-60740414 TCATTCGCAGACACAGAATTCGG + Intronic
1128059736 15:64727745-64727767 TCACTCCCACTCACCTAACTGGG + Intergenic
1129384467 15:75188331-75188353 TGACTCCCAGCCACAGCACTGGG + Intergenic
1130704045 15:86215188-86215210 TCACACACACACACAGAGCCAGG - Intronic
1131445514 15:92495417-92495439 TATTACCCACACACAGAACTGGG - Intronic
1131572755 15:93555713-93555735 TCCATCCCACGCACAGCACTTGG - Intergenic
1132409696 15:101567529-101567551 ACACACCCACACACAGAAGGAGG + Intergenic
1202966793 15_KI270727v1_random:183464-183486 TCCTTCCCATACAGAGAACTGGG - Intergenic
1132617303 16:847997-848019 TCCCTCCCGCACACAGCGCTTGG + Intergenic
1133253838 16:4503925-4503947 TAACTCACAAAGACAGAACTGGG - Intronic
1133490667 16:6264936-6264958 CGGTTCCCACACACAGAACTCGG - Intronic
1133842127 16:9419540-9419562 ACATTCACACACACAGAACCTGG + Intergenic
1134045605 16:11098764-11098786 TTACTCCCACACACAGCACTTGG - Intronic
1134204884 16:12229026-12229048 TCATTCCTTCACACAGACCTTGG + Intronic
1134837891 16:17377175-17377197 TCACACACACACACAAAATTAGG + Intronic
1135270812 16:21068057-21068079 TCACTCCCACAAACAAAGCAGGG + Intronic
1135614979 16:23903288-23903310 TCACTCCCCCACACACACGTGGG - Intronic
1138678025 16:58665890-58665912 TCTCTCCCACGCACATAATTGGG - Exonic
1138923670 16:61564935-61564957 TCACTTCCACAAACTGAACTGGG - Intergenic
1138923787 16:61566090-61566112 TCACCTCCACAAACTGAACTGGG - Intergenic
1140751189 16:78025470-78025492 GCACTCCCATACACAGAAGATGG - Intronic
1140842223 16:78850135-78850157 ACACTCACACACACAGAAACTGG - Intronic
1141133642 16:81451741-81451763 TGACTTCCACCCACAGAACAAGG + Intronic
1141258501 16:82427763-82427785 TCACTCATACACACAAAATTAGG + Intergenic
1141783422 16:86181261-86181283 ACACCCCCATACACAGAACATGG + Intergenic
1141982223 16:87557591-87557613 TAACTCACACACACAGATCCTGG + Intergenic
1142247260 16:88975834-88975856 TGACACTCACACACAGAACCCGG - Intronic
1142653236 17:1371061-1371083 ACACACTCACACACAGTACTTGG - Intronic
1143262451 17:5609810-5609832 TCTCTCATAGACACAGAACTGGG - Intronic
1145411173 17:22666812-22666834 TATCCCCCACACACAAAACTAGG - Intergenic
1145770808 17:27491758-27491780 CCACTTCCCCACACAGACCTGGG - Intronic
1147293130 17:39459756-39459778 TCACACACACACACAAAATTAGG + Intergenic
1147389059 17:40098356-40098378 CCACTGACACACACTGAACTGGG + Intronic
1148337045 17:46848936-46848958 ACACACACACACACAGAGCTTGG + Intronic
1149046286 17:52249555-52249577 TCACTCCTCCACCCAGAGCTAGG + Intergenic
1149077528 17:52614405-52614427 ACACACACACACACACAACTTGG + Intergenic
1149976553 17:61271582-61271604 ACACACACACACACAGAGCTGGG - Intronic
1150662805 17:67099201-67099223 TCACTTCCCGAAACAGAACTGGG - Intronic
1151478413 17:74356294-74356316 CCCCACCCAGACACAGAACTAGG - Intergenic
1152810591 17:82380127-82380149 TCACACCCACACCCACAGCTGGG + Intergenic
1153927852 18:9850164-9850186 TCATTCCGGCAAACAGAACTTGG - Intronic
1154497092 18:14969829-14969851 TGGCTCCCTCACACAGGACTAGG + Intergenic
1154532608 18:15362895-15362917 TCTCTCCCCCTCACACAACTGGG + Intergenic
1154963004 18:21328722-21328744 GAACTCCCAGACATAGAACTGGG + Intronic
1155698417 18:28712547-28712569 ACACTCCCAGACAGAGACCTAGG - Intergenic
1157067925 18:44373810-44373832 TCAGGCACACACACAGAACTGGG - Intergenic
1157956982 18:52109943-52109965 ACACACACACACACAAAACTAGG - Intergenic
1160076832 18:75685422-75685444 GCACCTCCACACTCAGAACTGGG - Intergenic
1160387092 18:78503369-78503391 TCCCTCCCACATACAGGGCTCGG + Intergenic
1160715124 19:572947-572969 TCACGCCCACACACAGAGGCCGG - Intronic
1161066524 19:2241205-2241227 GCACTCCCACACACAGATCTCGG - Intronic
1161863420 19:6816537-6816559 ACACACACACACACAGAACGTGG + Intronic
1162151341 19:8647821-8647843 ACACACACACACACACAACTGGG + Intergenic
1165226317 19:34357697-34357719 TCACTGACACACACAGGCCTGGG - Intergenic
1166885497 19:45958346-45958368 ACACACACACACACAGCACTTGG - Intronic
1166964976 19:46524041-46524063 ACACACACACACACAAAACTAGG - Intronic
1168270711 19:55248274-55248296 TCACTCCGCCACACAGGACAAGG + Intronic
1168344346 19:55643095-55643117 TCACTCCCACACACACCCCCTGG + Exonic
927810441 2:26177642-26177664 ACACACACACACACAGAACTGGG - Intronic
930665161 2:54094527-54094549 ACACACACACACACACAACTGGG - Intronic
932281725 2:70498652-70498674 TCACTGCCACACACAAAACCAGG - Intronic
932569834 2:72932786-72932808 TCACTGCCAGACACAGAATAGGG + Intronic
932818184 2:74878309-74878331 AAACTCTCACACACACAACTTGG + Intronic
935895684 2:107734765-107734787 TCTCTCCCACACACACATCCTGG + Intergenic
935977422 2:108592452-108592474 CCCCTCCCACACACAAAAATTGG - Intronic
937661392 2:124433583-124433605 ACAATCCCACCCACAGAACATGG + Intronic
940400339 2:153241640-153241662 ACACATACACACACAGAACTTGG - Intergenic
940898006 2:159099572-159099594 GCACACACACACACAGACCTAGG - Intronic
940986421 2:160056442-160056464 CCACTCCCACAAACACAGCTTGG + Intronic
941424705 2:165327968-165327990 TCACACTCACACACATACCTGGG - Intronic
941788018 2:169520145-169520167 ACACACACACACACAGAGCTAGG - Intronic
942132004 2:172889545-172889567 TAATTCCCACTCACAGAACGAGG + Intronic
943170685 2:184394711-184394733 ACACACACACACACACAACTGGG - Intergenic
943374551 2:187059503-187059525 ACACACACACACACAGAGCTAGG + Intergenic
943689812 2:190858100-190858122 TCACACACACACAGGGAACTTGG + Intergenic
944919146 2:204392713-204392735 ACACACACACACACAGAAATGGG - Intergenic
944986544 2:205183725-205183747 ACACACACACACACACAACTTGG - Intronic
945279226 2:208019429-208019451 TCCCACCCACACACACAACCTGG + Intronic
945613784 2:212041035-212041057 TAACTCCCACTGATAGAACTGGG - Intronic
946057646 2:216915961-216915983 TCCCTCCCGCACACAGCACGTGG - Intergenic
946631112 2:221670462-221670484 TCCCAACGACACACAGAACTGGG + Intergenic
946645847 2:221832918-221832940 TCACTCCTCCAGACACAACTTGG + Intergenic
947265659 2:228277299-228277321 ACACACACACACACAAAACTTGG + Intergenic
1169832658 20:9840892-9840914 TCCCTCCCACCCACAGATGTTGG - Intergenic
1170035053 20:11981295-11981317 GCACACACACACACAGAACCTGG - Intergenic
1172272186 20:33660841-33660863 TCACTCATACACACAACACTGGG + Intronic
1172283740 20:33726302-33726324 CCACCCCCACACACACAAATTGG - Intergenic
1172391524 20:34568457-34568479 GCCTTCCCACACACAGACCTGGG + Intronic
1172572166 20:35979241-35979263 TCACAACCACACACAGATCTAGG - Intronic
1173431290 20:42989153-42989175 TCAGTACCACCCACATAACTTGG - Intronic
1173609593 20:44356838-44356860 TCACACACCCGCACAGAACTTGG + Intronic
1173705967 20:45110538-45110560 TCACTGCAACACAGGGAACTGGG + Exonic
1174467456 20:50729248-50729270 ACACTCACTCACACAGAGCTGGG + Intergenic
1175072403 20:56345466-56345488 TCTCTCCCCAACACAGACCTGGG + Intergenic
1175446152 20:59021137-59021159 TAACTCACACACAGAGAAGTGGG + Intronic
1175479176 20:59299809-59299831 AGCCTCCCACACACAGGACTTGG + Intergenic
1176227574 20:64010372-64010394 TCACTTCCAGACACTGAACCTGG - Intronic
1176764752 21:13005316-13005338 TCTCTCCCCCTCACACAACTGGG - Intergenic
1177363724 21:20105657-20105679 TCATTCCCAGACTCAGAAATTGG - Intergenic
1177948553 21:27503997-27504019 ACACACACACACACACAACTAGG + Intergenic
1177953129 21:27563831-27563853 TCACACACACACACACAAATTGG - Intergenic
1178192343 21:30299064-30299086 TGACTCTCACACTGAGAACTAGG - Intergenic
1178250808 21:31001572-31001594 TCAGTTTCACACACAGAAATAGG + Intergenic
1179022843 21:37655929-37655951 TCTTTCCCACACACAGCCCTGGG + Intronic
1179139313 21:38710179-38710201 CCACTTCCACACACACCACTTGG + Intergenic
1180511937 22:16100119-16100141 TCTCTCCCTCTCACACAACTGGG - Intergenic
1183685129 22:39357339-39357361 TCACTCCCATGCATAGACCTGGG - Intronic
1184416573 22:44355331-44355353 GCACCCCCTGACACAGAACTTGG - Intergenic
1184858320 22:47158579-47158601 CTCCTCCCACACACAGGACTGGG - Intronic
1184902003 22:47452134-47452156 ACACACACACACACAGCACTGGG + Intergenic
1185131215 22:49040069-49040091 CAATTCCCATACACAGAACTTGG + Intergenic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
950489361 3:13294216-13294238 GCACTCCCACACTCAAACCTAGG - Intergenic
950497711 3:13343939-13343961 TCACTGCTTCACACAGAGCTAGG - Intronic
950981413 3:17310460-17310482 GCACTCACACACACAGGATTTGG - Intronic
951032918 3:17903047-17903069 TCAGTCCCTAACCCAGAACTTGG - Intronic
951053527 3:18121566-18121588 CCTCTCCTTCACACAGAACTTGG + Intronic
951276369 3:20691372-20691394 ACATTCCCACACACAGTTCTTGG - Intergenic
951565292 3:24006914-24006936 TCACTCCCAAACACAAAAGGTGG - Intergenic
952026717 3:29091604-29091626 TTACTCCCTCAAAAAGAACTTGG - Intergenic
953576446 3:44116537-44116559 TCAGTGCCAGACACTGAACTAGG - Intergenic
954693805 3:52409969-52409991 TCAGTCCCACACACAGACAACGG + Exonic
955087273 3:55715463-55715485 TCATTCCCACACACTGAACTTGG + Intronic
955968765 3:64415608-64415630 ACACACACACACACAAAACTAGG + Intronic
959027427 3:101256587-101256609 ACACACACACACAGAGAACTAGG + Intronic
959824453 3:110777387-110777409 TTACTCCCAATCATAGAACTTGG - Intergenic
961346188 3:126264951-126264973 TAACTCCCTGACTCAGAACTCGG - Intergenic
961436779 3:126924589-126924611 TCTCTCCCACTCACACAACCAGG - Intronic
961972583 3:130986101-130986123 TCACTGCCACCCAGAGAGCTGGG + Intronic
962059592 3:131911538-131911560 ACACACACACACACACAACTTGG - Intronic
963443035 3:145365392-145365414 ACACTCACACACACATACCTAGG - Intergenic
963566220 3:146934462-146934484 TCACTGCCCCTCACAGCACTAGG - Intergenic
964623419 3:158736907-158736929 TCACTCCCCCACACAGTATGTGG - Intronic
965005632 3:163019144-163019166 TCAGTCCCACAGACTGAAGTGGG + Intergenic
967906899 3:194509006-194509028 TCACTCCCACACTCAGAACAAGG - Intergenic
970099010 4:12499052-12499074 TTAATGGCACACACAGAACTGGG + Intergenic
970379181 4:15489444-15489466 TCACTACCTCACACAGTACTGGG + Intronic
970993717 4:22241001-22241023 GAACTCCCACACACAGGAGTAGG + Intergenic
972164422 4:36265289-36265311 TCACTGCCACACCCAGACATTGG - Intergenic
973793411 4:54399102-54399124 TTTTTCCCACATACAGAACTGGG - Intergenic
973801837 4:54486112-54486134 ACACACACACACACAGAATTGGG + Intergenic
973866918 4:55124130-55124152 TCACACCCACATACAGTACCAGG - Intronic
977818734 4:101446625-101446647 TCATTCCCACACAAAGACTTTGG - Intronic
978375916 4:108075669-108075691 TCAATCCCATACAAAGTACTTGG + Intronic
979154982 4:117374193-117374215 TCACACACACACACAAAACCTGG - Intergenic
981284637 4:143001716-143001738 TCACTCCAACACCGAGAAATTGG - Intergenic
981652924 4:147079431-147079453 TCGCTTCCACACACAGCACTGGG + Intergenic
984409317 4:179375154-179375176 ACACTACCACACACATCACTTGG + Intergenic
984608485 4:181811727-181811749 TCACTACCACAAACAGAATGGGG + Intergenic
985341122 4:188955707-188955729 TCGTTATCACACACAGAACTTGG - Intergenic
985638146 5:1050166-1050188 TCACTTCAACACACAGCACTAGG + Intergenic
985776563 5:1847264-1847286 TCACTCCCACACCCAGTGCGTGG - Intergenic
987284664 5:16443765-16443787 GAACTCCCATGCACAGAACTAGG + Intergenic
988966120 5:36419753-36419775 ACACACACACACACAGATCTGGG + Intergenic
989634482 5:43519814-43519836 ACACACACACACACACAACTTGG - Intergenic
990656154 5:57958277-57958299 TCACACCCATACAGAGCACTGGG + Intergenic
992410926 5:76504572-76504594 GCAATCACACACACAGATCTGGG - Intronic
996872970 5:128212444-128212466 ACACTCCCTCACAAAGAACAAGG - Intergenic
997308034 5:132855104-132855126 TCACACTCAAGCACAGAACTAGG + Intergenic
999204710 5:149839851-149839873 TCAGGCCCACACACAGCCCTGGG + Intronic
999452713 5:151690332-151690354 TCACTCCCAGAAAGAAAACTTGG + Intergenic
999974621 5:156898867-156898889 ACACACACACACACAGAAGTAGG - Intergenic
1000107347 5:158072880-158072902 CCACACCCACACACAGAAACAGG - Intergenic
1000153127 5:158522973-158522995 ACTTTCCCACACACAGGACTTGG + Intergenic
1000249541 5:159481004-159481026 CCACACCCACACACAGATTTTGG + Intergenic
1000603896 5:163307577-163307599 ACACACACACACACAGAGCTGGG - Intergenic
1000663667 5:163967893-163967915 ACACACACACACACAGAACTAGG - Intergenic
1003159004 6:3619368-3619390 CCACTCCCCCACCCAGAAATAGG - Intergenic
1004797861 6:19109058-19109080 ACACACACACACACACAACTGGG - Intergenic
1007106132 6:39284325-39284347 TTCCTTTCACACACAGAACTGGG + Intergenic
1007466356 6:42054304-42054326 TCACTACCACACACACAAAAAGG - Intronic
1007705095 6:43785652-43785674 CCACTCACACACACACAACCAGG - Exonic
1007924238 6:45638696-45638718 TCACTGCCACACACAGACAATGG + Intronic
1009659655 6:66594279-66594301 TCTCTCACACACACACAACCTGG + Intergenic
1012132743 6:95517796-95517818 TCACTCCCTGACATAGCACTAGG + Intergenic
1012532693 6:100257238-100257260 CCACACACACACACAGAACCTGG + Intergenic
1012821106 6:104085391-104085413 ACACACACACACAAAGAACTTGG - Intergenic
1013010439 6:106115419-106115441 GCACTCCCACACAAATTACTGGG - Intergenic
1014457062 6:121648171-121648193 ACACACCCACACACAAAAGTAGG + Intergenic
1014882813 6:126744399-126744421 ACACACACACACACACAACTGGG + Intergenic
1015472695 6:133623816-133623838 CCACTCTAACACATAGAACTAGG + Intergenic
1017219528 6:151949894-151949916 TCACTCACTGACACAGAACCTGG - Intronic
1019301559 7:306788-306810 ACACTCCCCCACCCAGAACTGGG + Intergenic
1019835318 7:3377690-3377712 TCACTGCCACACACAGGGCAGGG + Intronic
1019923364 7:4176983-4177005 CGACTTCAACACACAGAACTTGG + Intronic
1020072190 7:5234388-5234410 TCCCTGCCACAGAGAGAACTGGG + Intergenic
1020085666 7:5308943-5308965 TCTCTCCCCCACACAGCACTGGG - Exonic
1020277828 7:6635659-6635681 TCAGTCCCACCCACAGAAGCTGG + Intergenic
1021867543 7:24973217-24973239 CCACACCCACTCAGAGAACTGGG + Intronic
1022667027 7:32421097-32421119 ACACACACACACACAGCACTAGG + Intergenic
1024171758 7:46795174-46795196 TTACTCCAATACAAAGAACTGGG - Intergenic
1024511925 7:50211597-50211619 CCCCTTCCACAGACAGAACTTGG + Intergenic
1025208644 7:57008221-57008243 TCTCTCCCCCACACAGCACTGGG + Intergenic
1025663303 7:63568657-63568679 TCTCTCCCCCACACAGCACTGGG - Intergenic
1025758452 7:64368346-64368368 TGACTCACACACACAGAGCCAGG + Intergenic
1030391777 7:108937472-108937494 ACACTCACACACACACAAATGGG - Intergenic
1030996567 7:116366477-116366499 ACACACACACACACAGAATTAGG + Intronic
1031189958 7:118536126-118536148 TCCCTCTCACACACACAACCTGG + Intergenic
1032705842 7:134420719-134420741 TCACTCACAGACACACCACTTGG - Intergenic
1032902314 7:136323744-136323766 CCACACACACACACAGATCTGGG - Intergenic
1033447007 7:141432075-141432097 TCACATTCACACACAAAACTTGG - Intronic
1034427816 7:151023856-151023878 CCACACCCACACACATACCTCGG + Exonic
1034470104 7:151250337-151250359 ACACCCCCACACACAGAGCCTGG + Intronic
1035539110 8:418043-418065 GCACTGACACACACACAACTTGG - Intronic
1035893662 8:3373290-3373312 TCCATACCACACACAGAACCCGG + Intronic
1036753027 8:11455198-11455220 TCACACACACACACAGAGCAAGG - Intronic
1040060872 8:43101901-43101923 CCACTCCCATATACAGAGCTGGG - Intronic
1043778314 8:84298791-84298813 TCACACACACACACAAAGCTAGG - Intronic
1045254937 8:100511431-100511453 ACACACACACACACACAACTTGG - Intronic
1047199845 8:122755886-122755908 GCACTCCCAGAAGCAGAACTGGG + Intergenic
1047612005 8:126530194-126530216 TCATTCTGACACACTGAACTTGG - Intergenic
1048202266 8:132384262-132384284 TCCCTACCAGACACAGTACTAGG - Intronic
1048493091 8:134912803-134912825 TGACTCCTACACACAGGGCTTGG + Intergenic
1049134727 8:140885871-140885893 TCACTCCTCCACTCAGAACCCGG - Intronic
1050882890 9:10725910-10725932 ACACACACACACACAGAACAAGG + Intergenic
1050934497 9:11378113-11378135 ACACACACACACACAGAACAAGG + Intergenic
1050938975 9:11435224-11435246 TAACACCCACACACAGACTTTGG + Intergenic
1050962487 9:11752804-11752826 TCATTCCCACTCACAGGATTTGG + Intergenic
1053710318 9:40800614-40800636 TCTCTCCCCCTCACACAACTGGG + Intergenic
1054420225 9:64921403-64921425 TCTCTCCCCCTCACACAACTGGG + Intergenic
1055166655 9:73203575-73203597 TCACTGTGACACACATAACTAGG + Intergenic
1057084440 9:92196038-92196060 ACACACACACACACAGAAATTGG + Intergenic
1057899897 9:98940466-98940488 TCCCTCCCACACCCACAGCTGGG + Intergenic
1059263711 9:113005831-113005853 TCAGTGCCACCCACAGAACCTGG + Intergenic
1059320599 9:113465432-113465454 ACACACACACACACAGAAATAGG - Intronic
1060045062 9:120333301-120333323 CCAAAGCCACACACAGAACTGGG - Intergenic
1061299123 9:129694753-129694775 ACACACACACACACAGAGCTTGG - Intronic
1061876307 9:133545866-133545888 ACACTCCCCCTCGCAGAACTTGG + Intronic
1186048165 X:5559169-5559191 ACACACACACACACAAAACTAGG - Intergenic
1190304891 X:49076324-49076346 GCACTCACACACAGAGAAATGGG - Intronic
1192193851 X:69015701-69015723 TCACTCCCCCACACCTATCTGGG - Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1192583489 X:72303217-72303239 TCACCCCCACACATACACCTTGG - Intronic
1195706429 X:107741143-107741165 GCACTGCCACTCACAGAACTAGG + Intronic
1196817034 X:119673372-119673394 TCACTCCCACACACCAACTTTGG - Intronic
1196917158 X:120549169-120549191 CCACTCCAACCCACAGAACTTGG - Intronic
1197007994 X:121526574-121526596 TCACACACACACACACATCTTGG + Intergenic
1197903365 X:131396808-131396830 GCACTGCCACACTCAAAACTAGG + Intronic
1199256903 X:145727741-145727763 CCCCTCCCACTCACAGAACTAGG + Intergenic
1202064759 Y:20926637-20926659 TCAGTCACACAGGCAGAACTAGG - Intergenic