ID: 903391989

View in Genome Browser
Species Human (GRCh38)
Location 1:22971219-22971241
Sequence GCTGCATTTTGAGGAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903391989_903392002 16 Left 903391989 1:22971219-22971241 CCCCCTCCTCCTCAAAATGCAGC No data
Right 903392002 1:22971258-22971280 CCAATTTGTAGCCCTCCTCTGGG No data
903391989_903392003 17 Left 903391989 1:22971219-22971241 CCCCCTCCTCCTCAAAATGCAGC No data
Right 903392003 1:22971259-22971281 CAATTTGTAGCCCTCCTCTGGGG No data
903391989_903392000 15 Left 903391989 1:22971219-22971241 CCCCCTCCTCCTCAAAATGCAGC No data
Right 903392000 1:22971257-22971279 CCCAATTTGTAGCCCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903391989 Original CRISPR GCTGCATTTTGAGGAGGAGG GGG (reversed) Intergenic
No off target data available for this crispr