ID: 903391992

View in Genome Browser
Species Human (GRCh38)
Location 1:22971222-22971244
Sequence CCAGCTGCATTTTGAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903391992_903392002 13 Left 903391992 1:22971222-22971244 CCTCCTCCTCAAAATGCAGCTGG No data
Right 903392002 1:22971258-22971280 CCAATTTGTAGCCCTCCTCTGGG No data
903391992_903392000 12 Left 903391992 1:22971222-22971244 CCTCCTCCTCAAAATGCAGCTGG No data
Right 903392000 1:22971257-22971279 CCCAATTTGTAGCCCTCCTCTGG No data
903391992_903392003 14 Left 903391992 1:22971222-22971244 CCTCCTCCTCAAAATGCAGCTGG No data
Right 903392003 1:22971259-22971281 CAATTTGTAGCCCTCCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903391992 Original CRISPR CCAGCTGCATTTTGAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr