ID: 903392003

View in Genome Browser
Species Human (GRCh38)
Location 1:22971259-22971281
Sequence CAATTTGTAGCCCTCCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903391987_903392003 21 Left 903391987 1:22971215-22971237 CCACCCCCCTCCTCCTCAAAATG No data
Right 903392003 1:22971259-22971281 CAATTTGTAGCCCTCCTCTGGGG No data
903391991_903392003 15 Left 903391991 1:22971221-22971243 CCCTCCTCCTCAAAATGCAGCTG No data
Right 903392003 1:22971259-22971281 CAATTTGTAGCCCTCCTCTGGGG No data
903391995_903392003 11 Left 903391995 1:22971225-22971247 CCTCCTCAAAATGCAGCTGGGAT No data
Right 903392003 1:22971259-22971281 CAATTTGTAGCCCTCCTCTGGGG No data
903391996_903392003 8 Left 903391996 1:22971228-22971250 CCTCAAAATGCAGCTGGGATCTC No data
Right 903392003 1:22971259-22971281 CAATTTGTAGCCCTCCTCTGGGG No data
903391990_903392003 16 Left 903391990 1:22971220-22971242 CCCCTCCTCCTCAAAATGCAGCT No data
Right 903392003 1:22971259-22971281 CAATTTGTAGCCCTCCTCTGGGG No data
903391989_903392003 17 Left 903391989 1:22971219-22971241 CCCCCTCCTCCTCAAAATGCAGC No data
Right 903392003 1:22971259-22971281 CAATTTGTAGCCCTCCTCTGGGG No data
903391988_903392003 18 Left 903391988 1:22971218-22971240 CCCCCCTCCTCCTCAAAATGCAG No data
Right 903392003 1:22971259-22971281 CAATTTGTAGCCCTCCTCTGGGG No data
903391992_903392003 14 Left 903391992 1:22971222-22971244 CCTCCTCCTCAAAATGCAGCTGG No data
Right 903392003 1:22971259-22971281 CAATTTGTAGCCCTCCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903392003 Original CRISPR CAATTTGTAGCCCTCCTCTG GGG Intergenic
No off target data available for this crispr