ID: 903392303

View in Genome Browser
Species Human (GRCh38)
Location 1:22972982-22973004
Sequence TCTGGGGTCCCCAAGCAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903392291_903392303 10 Left 903392291 1:22972949-22972971 CCCTCAGAGTGCCTGCTGCCATG No data
Right 903392303 1:22972982-22973004 TCTGGGGTCCCCAAGCAGCGGGG No data
903392292_903392303 9 Left 903392292 1:22972950-22972972 CCTCAGAGTGCCTGCTGCCATGG No data
Right 903392303 1:22972982-22973004 TCTGGGGTCCCCAAGCAGCGGGG No data
903392289_903392303 22 Left 903392289 1:22972937-22972959 CCCGGTGCTAATCCCTCAGAGTG No data
Right 903392303 1:22972982-22973004 TCTGGGGTCCCCAAGCAGCGGGG No data
903392296_903392303 -1 Left 903392296 1:22972960-22972982 CCTGCTGCCATGGGGATTAGCTT No data
Right 903392303 1:22972982-22973004 TCTGGGGTCCCCAAGCAGCGGGG No data
903392288_903392303 23 Left 903392288 1:22972936-22972958 CCCCGGTGCTAATCCCTCAGAGT No data
Right 903392303 1:22972982-22973004 TCTGGGGTCCCCAAGCAGCGGGG No data
903392290_903392303 21 Left 903392290 1:22972938-22972960 CCGGTGCTAATCCCTCAGAGTGC No data
Right 903392303 1:22972982-22973004 TCTGGGGTCCCCAAGCAGCGGGG No data
903392300_903392303 -8 Left 903392300 1:22972967-22972989 CCATGGGGATTAGCTTCTGGGGT No data
Right 903392303 1:22972982-22973004 TCTGGGGTCCCCAAGCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903392303 Original CRISPR TCTGGGGTCCCCAAGCAGCG GGG Intergenic
No off target data available for this crispr