ID: 903397045

View in Genome Browser
Species Human (GRCh38)
Location 1:23009605-23009627
Sequence GCCACTGTGTTAGGTGCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903397040_903397045 23 Left 903397040 1:23009559-23009581 CCACGCCTGGCCTAGGTATTCTT 0: 1
1: 1
2: 48
3: 363
4: 2453
Right 903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG 0: 1
1: 0
2: 3
3: 32
4: 198
903397042_903397045 13 Left 903397042 1:23009569-23009591 CCTAGGTATTCTTTATTGAGCAC 0: 1
1: 0
2: 2
3: 15
4: 132
Right 903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG 0: 1
1: 0
2: 3
3: 32
4: 198
903397041_903397045 18 Left 903397041 1:23009564-23009586 CCTGGCCTAGGTATTCTTTATTG 0: 1
1: 0
2: 2
3: 54
4: 571
Right 903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG 0: 1
1: 0
2: 3
3: 32
4: 198
903397039_903397045 26 Left 903397039 1:23009556-23009578 CCACCACGCCTGGCCTAGGTATT 0: 1
1: 7
2: 242
3: 1619
4: 9075
Right 903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG 0: 1
1: 0
2: 3
3: 32
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903397045 Original CRISPR GCCACTGTGTTAGGTGCTAC GGG Intergenic
900998309 1:6134615-6134637 GCCGCTGTGATAGGTTCTCCTGG - Intronic
902077560 1:13800124-13800146 GGCACTGTTTTAGGTGCCAGGGG + Intronic
902391256 1:16108318-16108340 GCCACTGGGTTAGGCTCTCCCGG - Intergenic
902711616 1:18243765-18243787 GCCCTTGTGTTGGGTGCTGCTGG + Intronic
903328853 1:22586686-22586708 GCCCCTGTGTTTGGTCCTCCAGG + Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
903948967 1:26982992-26983014 GCCACTGTGCAAGGTGCTAGAGG - Intergenic
906003867 1:42451944-42451966 GACCCTGTGTTAGGTGTTACAGG - Intronic
907846982 1:58217811-58217833 GGCTCTGTGTTAGGTACTATGGG - Intronic
912369736 1:109164725-109164747 CCCACTGGGTAAGGGGCTACAGG + Intronic
914782248 1:150796175-150796197 GATACTGTGTTAGGTGCTGGAGG - Intergenic
915190411 1:154145877-154145899 GCCAGTGTGCTTGTTGCTACTGG - Intronic
915947292 1:160162746-160162768 ACCACTGTGTTAGGGGATAAGGG + Intronic
915968777 1:160336915-160336937 GGCACTGTGTTAGGTGGTAAGGG - Intronic
916470096 1:165115444-165115466 AGCACTGTGCTAGGTACTACTGG - Intergenic
916906290 1:169288276-169288298 GACATTGTTTTAGGTGCTAGGGG - Intronic
917261601 1:173175342-173175364 GCCACTGTGTTAGGTGTTCTGGG - Intergenic
918305169 1:183239593-183239615 ACCCTTGTGTTTGGTGCTACTGG - Intronic
920829861 1:209454325-209454347 GGCACTGTGCTAGGTGTTTCAGG + Intergenic
920949394 1:210558156-210558178 GGCTCTGTGTTAGGTGTTATGGG - Intronic
921595111 1:217046267-217046289 GATACTGTGCTAGGTGCTATAGG - Intronic
921889395 1:220338719-220338741 GCCACCATGTTAAGTGCTTCTGG + Intergenic
924645898 1:245877093-245877115 GCCACGCTGTTGGGTGCTTCTGG + Intronic
1063555873 10:7079078-7079100 GCTGCTGTGTCAGGTGCTGCGGG - Intergenic
1065197245 10:23278497-23278519 GCCACCATGTTAGGTTTTACGGG + Intronic
1069885837 10:71623042-71623064 GCCACTGTGCTAGGTCCTGGGGG + Intronic
1071733776 10:88275061-88275083 GCCATTGTGTTGGGTGGCACTGG - Intronic
1076652383 10:131998829-131998851 GCCACTGTGTGAGGTGGCAGTGG + Intergenic
1078415650 11:11162632-11162654 GCCACTGTGTCTTGTGGTACAGG + Intergenic
1079158171 11:17968138-17968160 GGCTCTGTGTTAGGTGCTGTGGG - Intronic
1079938512 11:26648620-26648642 ACCACTGCTTTAGGTGATACAGG + Intronic
1080054031 11:27886756-27886778 GGCACTGTGTTAAATGCTGCAGG - Intergenic
1080681765 11:34483399-34483421 GGCAGTGTGCTAGGTGCTGCAGG - Intronic
1084918560 11:72450328-72450350 GCCACCATGTTGGGTGCTAGGGG + Intergenic
1088638586 11:111848924-111848946 GACAGTGTTTTATGTGCTACAGG - Intronic
1089043829 11:115481321-115481343 GCCACAGTGTCAAATGCTACAGG - Intronic
1089787226 11:120916492-120916514 GGCACTGTGTTAGGTGCATAAGG - Intronic
1090417983 11:126554036-126554058 GGAACTGTGTGAGGTGCTGCTGG - Intronic
1090419756 11:126566400-126566422 GGCACTGTGCTTGGTCCTACGGG - Intronic
1091728555 12:2863136-2863158 GCGCCTGTGGTGGGTGCTACTGG + Intronic
1091742660 12:2971081-2971103 GGCACTGTGCTAGGTGCAGCGGG + Intronic
1091957052 12:4654408-4654430 GCCACTGTGTTTGGAGCAACAGG + Exonic
1092113432 12:5981099-5981121 GGCACTGTGCTAGGTGCTATGGG - Intronic
1092893746 12:12993567-12993589 GCCACTGTGTTAGATACTTTGGG + Intronic
1092956365 12:13554143-13554165 GGCACTCTGTTTAGTGCTACAGG + Exonic
1093897464 12:24590826-24590848 ACCACTGGGTTAGGTGTTAAGGG - Intergenic
1094809588 12:34124426-34124448 GCCACTATCATAGGGGCTACTGG - Intergenic
1102215053 12:111154958-111154980 GCTGCTGTGGTAGGTGCTATGGG + Intronic
1104903637 12:132202235-132202257 GCAACTGAGTGAGGTGCTCCAGG - Intronic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1108448164 13:50529674-50529696 GACTCTGTGCTAGTTGCTACTGG + Intronic
1108519111 13:51229720-51229742 TCCACTGTGGTAGATGCAACAGG - Intronic
1113784508 13:112995465-112995487 GCCGCTGTGTGAGCTGCTGCTGG + Intronic
1115662802 14:35513271-35513293 TCAACTGTTTTAGGTGCTATGGG + Intergenic
1117747018 14:58879969-58879991 GGCCCTGTGTTAGGTGCTGTGGG - Intergenic
1118689555 14:68324964-68324986 GGCACTGTGTTAGTTGCTGTGGG - Intronic
1122503598 14:102217917-102217939 GCCTCTGTGGCAGGTGCTCCTGG - Intronic
1122574988 14:102736363-102736385 GCTACGGTTTTAGGTGCTTCTGG - Intergenic
1124660446 15:31546033-31546055 GGCATTGTGTTAGGTATTACAGG + Intronic
1124816128 15:32994630-32994652 GGCACTGTGCTAGGTGCTCGAGG - Intronic
1125333879 15:38608376-38608398 GCCTCTGTGTGAGGTGTTTCTGG - Intergenic
1125869549 15:43086807-43086829 GCCACTGTACTAGGTTGTACAGG - Intronic
1125896749 15:43308873-43308895 GCCTCTGTGTCAGGTGCTGAGGG + Intergenic
1127187459 15:56494123-56494145 GCCACTGTGCTGGGTGCTGTAGG - Intergenic
1128181244 15:65606588-65606610 GACACTGTGTTAGGCACTGCTGG + Intronic
1129155302 15:73713871-73713893 AGCACTGTGTTAGGTGCTGGGGG + Exonic
1131760616 15:95618682-95618704 GGCACTGTGCTAGGCGCTAGGGG + Intergenic
1131960163 15:97781843-97781865 GCAAATGTGTTATGTCCTACAGG - Intergenic
1135112285 16:19699600-19699622 GCCTCTGTGCCAGGTGCCACAGG - Exonic
1135149943 16:19996644-19996666 GGCATTGTGTTAGGTGCTGGGGG - Intergenic
1136677318 16:31922465-31922487 GCCATTGTGTGAGGAGCTTCTGG + Intergenic
1138700716 16:58860034-58860056 GCCACTGTGTCAGGGGTTGCTGG + Intergenic
1139663070 16:68435515-68435537 ACCTCTGTGTTAGGGGATACGGG - Intronic
1142546771 17:709625-709647 GTCACTGTGCTAGGTGCTGAGGG - Intronic
1143388702 17:6547511-6547533 GGCACAGTGGCAGGTGCTACGGG - Intronic
1148578461 17:48727377-48727399 GCCACTCTTTTAGATTCTACAGG + Intronic
1150067721 17:62125461-62125483 GACACTGTGTTAGGTGCCGGTGG - Intergenic
1151328215 17:73391685-73391707 GACACTGTGTTAGGAGCCAGGGG + Intronic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1153463226 18:5360475-5360497 GACACTGGGTTAGTTACTACTGG - Intergenic
1156448272 18:37252799-37252821 GCTACTGTGTTAGGTACTTGGGG - Intronic
1156514728 18:37670164-37670186 GCCACTCTCTCAGGTGCTCCAGG - Intergenic
1156534527 18:37849825-37849847 GTCACTGTGCTAAGTGCTAAGGG + Intergenic
1156556899 18:38078099-38078121 GCCAATGTGTCAGCTGCTAGGGG - Intergenic
1157713583 18:49866719-49866741 GGCACTGTGCTAGGTGCTGCAGG + Intronic
1158364839 18:56722406-56722428 TCCACTGTATTAGATACTACTGG - Intronic
1158986837 18:62826573-62826595 GCCACTATGCTAGATGCTAGAGG - Intronic
1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG + Intronic
1163103741 19:15111681-15111703 GCCCCTGTATAAGGTGGTACTGG + Exonic
1163726119 19:18924137-18924159 GCCACTGTGCTAGGTGTCTCAGG + Intronic
1164714130 19:30379271-30379293 GCCTCTGTGTTGGGAGCTCCCGG + Intronic
925797529 2:7563116-7563138 GGCTCTGTGTTAGGTGCTATGGG - Intergenic
926301285 2:11605024-11605046 GCCTCTGTGGTAGGTACTAAAGG - Intronic
928420739 2:31136567-31136589 GGCAGTGTGTTAGGTGCTATGGG - Intronic
931179490 2:59885253-59885275 GTCATTGTGTTAAGTGCTAAAGG - Intergenic
931201527 2:60102085-60102107 GGCACTGTGCTTGGTGCCACAGG - Intergenic
931681576 2:64753564-64753586 GCCCCTGTGTCAGTTGTTACTGG + Intergenic
931896863 2:66741921-66741943 GGCACTGTGGTAGGAGCTACAGG + Intergenic
932613651 2:73218336-73218358 GGCACTGTGCTAGGTGCTGTGGG + Intronic
933276023 2:80285235-80285257 ACCAGTGTGGTAGATGCTACTGG - Intronic
933701628 2:85259125-85259147 GCCACTGTGTGTGGTGCTGTGGG - Intronic
935733997 2:106091685-106091707 ACCACTGTGTTAGTTGGTTCAGG + Intergenic
935918922 2:107988232-107988254 GCCACTGTTTTTGGTTCTCCAGG - Exonic
938927894 2:136061102-136061124 GGCATTGTGTTAGGTGCTTCAGG - Intergenic
938970521 2:136426882-136426904 GACACTGTGTTAGGTGCCAGGGG + Intergenic
939415445 2:141890278-141890300 GCCACTGTGCTAAGTGCTCAGGG - Intronic
940736384 2:157457493-157457515 GCCACTCTTCTAGGTGCTAGAGG - Intronic
941162231 2:162048884-162048906 TGAACTGTGTTAGGTGCTAAAGG - Intronic
941603872 2:167571541-167571563 CCCTCTGTGTGAGGTGCTATGGG - Intergenic
943052766 2:182936791-182936813 GACACTGTGCTGAGTGCTACAGG - Intronic
943446109 2:187990000-187990022 GCCATTGTCTTTTGTGCTACTGG + Intergenic
943797633 2:192017133-192017155 GCCATTGTTTAAGGAGCTACAGG + Intronic
1169594785 20:7185745-7185767 GCCAATGTGTTATGTGTTCCTGG - Intergenic
1170984184 20:21242971-21242993 GACACTGGGCTAGGTGCTGCAGG - Intronic
1172163133 20:32882391-32882413 GGAACTGTGTGAGGTGCTGCTGG - Intronic
1174773495 20:53322884-53322906 GCCTCTGTGTTTGGTGCTCATGG + Intronic
1174890585 20:54387756-54387778 GCCATTGTTTTATGTGCTTCTGG + Intergenic
1175543907 20:59765811-59765833 GTCACTGTGTTAGCTCCTATGGG - Intronic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
1179052138 21:37897057-37897079 GCCACAGTGTTTGTTCCTACAGG - Intronic
1182232876 22:28852111-28852133 GCCACTGTATTAGGTAGCACAGG - Intergenic
1183136959 22:35898216-35898238 GCCACTGGGTTTGGAGCAACAGG - Intronic
1183771340 22:39928554-39928576 CCTACTGTGTTGGGTGCTATGGG + Intronic
950169093 3:10824182-10824204 GCCACTGTGTATGGTTATACAGG - Intronic
951568244 3:24034668-24034690 GGCACTGTCCTTGGTGCTACAGG + Intergenic
951574780 3:24102479-24102501 GGCACTGTGTTAGGTGCTGTAGG - Intergenic
952130421 3:30355470-30355492 GCCAGTGTCTTAGGTGTAACTGG + Intergenic
952212367 3:31241257-31241279 GGCACGGTGTCAGGTGCTAGGGG - Intergenic
952974448 3:38682049-38682071 GCCCCAGTGGTATGTGCTACAGG + Intergenic
953417253 3:42730119-42730141 GGCACTGTGCTTGGTGCTGCTGG - Intronic
953618353 3:44511622-44511644 GCCAGTGTGTTATGAGCTACCGG - Intergenic
954714803 3:52521678-52521700 GCCACGCTGTGAGGTGCAACTGG + Exonic
955760149 3:62271430-62271452 GCCACTGTGTATAGTGATACTGG - Exonic
956095993 3:65716767-65716789 GGCTTTGTGTTAGGTGCTAGGGG + Intronic
957036453 3:75297887-75297909 GACACTGTGCTGGGTGCTGCAGG + Intergenic
957714656 3:83910227-83910249 GGCACTGTGGTAGGAGCTACAGG - Intergenic
957714898 3:83914603-83914625 GGCACTGTGGTAGGAGCTACAGG - Intergenic
959020620 3:101184185-101184207 GGAACTGTGTAAGGTGCTGCTGG + Intergenic
962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG + Intergenic
962961007 3:140310902-140310924 GCCTCTGTGTTAGGTGCTGCAGG + Intronic
963941551 3:151100849-151100871 TCCACTGTGTTAGGTGATATGGG + Intronic
964055452 3:152450733-152450755 GCTACTGTGTTAGGTTGTGCGGG - Intronic
964638758 3:158885947-158885969 CCCACAGTGTTAGCTGCCACTGG - Intergenic
965616955 3:170603718-170603740 TTCATTGTGGTAGGTGCTACTGG + Intronic
965666119 3:171095212-171095234 GGCACTGTGCTCTGTGCTACAGG - Intronic
965837853 3:172870915-172870937 GACCCTGTGTTAGGAGCCACCGG + Intergenic
966063927 3:175793806-175793828 GTCACTGTGTTAGTTGCTTAGGG - Intronic
966424261 3:179764055-179764077 GCCTCTGTTTTTGGTGCTTCTGG + Exonic
967220998 3:187248036-187248058 GGCACTGTGCTAGGTCCTAGGGG - Intronic
968135954 3:196219731-196219753 GCCACACTGGAAGGTGCTACTGG + Intronic
969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG + Intronic
970003963 4:11393096-11393118 GGCACTGTGTTAAGTGCCAGAGG + Intergenic
970724748 4:19030663-19030685 GCCACTGTCTCAGGTGCCAGGGG + Intergenic
972299636 4:37772626-37772648 GGCACTGTGCTAGGTGCTAATGG + Intergenic
973801586 4:54483690-54483712 GTCACTGTGCTAGGTGCTTGGGG + Intergenic
978066338 4:104407371-104407393 GGCACTGGGTTAGGTGCTGATGG + Intergenic
978393784 4:108256040-108256062 GGCATTGTGCTAAGTGCTACAGG + Intergenic
978553718 4:109955790-109955812 GGCACCGTGCTAGGTGTTACTGG + Intronic
979201434 4:117984093-117984115 GCCACTGTGTTCTAAGCTACTGG + Intergenic
980893780 4:138841560-138841582 GCCTCTGTGTTAGGTGCCCCAGG - Intergenic
980966439 4:139525754-139525776 GCCAGTGGGTTAGGGGGTACAGG - Intronic
981930827 4:150187658-150187680 GGCACTATTCTAGGTGCTACAGG - Intronic
982194415 4:152895886-152895908 GTCACTGAGTTAGGTGATAGAGG + Intronic
988670682 5:33377860-33377882 GCAAATGTGTTAGATGGTACAGG - Intergenic
989142056 5:38211173-38211195 GCCACTGTCCTAGGTGCTGGAGG - Intergenic
989268464 5:39504486-39504508 GCCACTGTCTGAGGCTCTACAGG + Intergenic
990508915 5:56472161-56472183 ACCACTGTGGTAGGGGCTGCTGG - Intronic
993190327 5:84672233-84672255 GAAACTGTGTGAGGTGCTGCTGG + Intergenic
995536953 5:113146190-113146212 GAGACTGTGCTGGGTGCTACAGG + Intronic
997216440 5:132114991-132115013 GCCTCTGTCCTAGGTGCTATGGG - Intergenic
1000408977 5:160918160-160918182 GACACTATGTTAGGTGCTAAGGG + Intergenic
1001329047 5:170749366-170749388 GCCTCTGTGTTTGGTTCCACCGG - Intergenic
1001419035 5:171573025-171573047 GACACTGTGCTTGGTGCTAGAGG - Intergenic
1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG + Intergenic
1002500474 5:179644443-179644465 GCCTCTGTGTGAGGTGCTCTGGG - Intronic
1004175067 6:13332684-13332706 ACCACTGTGTTAAGTGATACAGG - Intergenic
1004484899 6:16057270-16057292 GCCACTGTGGAAGGTGCTATAGG - Intergenic
1005765646 6:29009045-29009067 GGCACTGTGCAAGGAGCTACAGG + Intergenic
1006427873 6:33977473-33977495 GGCACTGCTCTAGGTGCTACAGG - Intergenic
1006512275 6:34528147-34528169 GGCACTGTGTTAGGTGGTGCAGG - Intronic
1006686282 6:35837240-35837262 GTGACTGTGTTAGGTGTCACTGG + Intronic
1006803050 6:36771612-36771634 GGCACTGTGTTGGGTGCTGTGGG - Intronic
1007718049 6:43868778-43868800 GCCTCTGTATCAGGTGCTAGAGG - Intergenic
1007909078 6:45495057-45495079 GCCACTGTGTTATCTTCTTCAGG + Intronic
1012430289 6:99156980-99157002 AGCACTGTGTCAGGAGCTACGGG + Intergenic
1012723419 6:102778522-102778544 GCCACTGTGTCAGGTAGTAAAGG - Intergenic
1012754048 6:103201841-103201863 TCCACTGTATTAGGTTCTAGAGG + Intergenic
1013471155 6:110467515-110467537 CACACTGTGCTGGGTGCTACAGG - Intronic
1013552111 6:111217944-111217966 GGCACTGTGCTATGTGCTAGAGG - Intronic
1013639384 6:112058442-112058464 GGCACTGTGCTAGGTGCTGGTGG + Intronic
1015631350 6:135235152-135235174 GGCACTGTATTAAGTGCTATGGG - Intergenic
1017979355 6:159386072-159386094 GCCACTGTGTTAGGAGGTTGTGG + Intergenic
1020150996 7:5681538-5681560 GACACTGTCCTTGGTGCTACAGG - Intronic
1021601145 7:22364836-22364858 GCCACTGTATTAGATGCGAGAGG - Intergenic
1021804750 7:24343686-24343708 GCAGCTGTGTGATGTGCTACAGG - Intergenic
1023242856 7:38167578-38167600 GCCACTGGGTTAGGGTCTCCCGG - Intergenic
1024035472 7:45504452-45504474 GCCTCTGGGTTGGGGGCTACAGG - Intergenic
1026123481 7:67558623-67558645 CCCCCTGTTTTTGGTGCTACAGG + Intergenic
1029093941 7:98070337-98070359 GACACTGTAATAGGTGCTACGGG - Intergenic
1029521383 7:101064867-101064889 GGCACGGTGTTAGGTGCTGTGGG - Intergenic
1030077969 7:105752811-105752833 GCCACTGTGTTGAGGACTACAGG - Intronic
1032022490 7:128416729-128416751 GGCACTGTGCTAGGTGTTAGAGG + Intergenic
1032874998 7:136028875-136028897 GGCACTGTAATAGGTGCTAGAGG - Intergenic
1034202388 7:149290523-149290545 GGCACTGTGTAAGGTGCTAGAGG - Intronic
1034576727 7:152006171-152006193 GCCACTGTGTTGGATGCTGCTGG - Intronic
1038837887 8:31148881-31148903 GGCATTGTGCTAGGTGCTACAGG - Intronic
1044632573 8:94293458-94293480 GCCACTGTCATGGGTGCTGCAGG + Intergenic
1044680331 8:94771403-94771425 GGCATTGTGCTAGGTGCTAAAGG + Intronic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG + Intronic
1046183732 8:110686276-110686298 GCCACTGTGCTAGGTGCTGTGGG + Intergenic
1046773986 8:118144445-118144467 GGCACTGTGCTAGGTGCTTTGGG - Intergenic
1053377828 9:37623134-37623156 GACACTGTGTTAGGTGCTGAGGG + Intronic
1055687237 9:78789802-78789824 GACACTGTGATAGTTGCTGCAGG + Intergenic
1055759033 9:79587112-79587134 GGCATTGTTTTAGGTGCTAGTGG - Intronic
1056100504 9:83296435-83296457 AGCACTGTGTTAGGTGCTGGGGG + Intronic
1056136685 9:83636224-83636246 GCCACTGTTGTAGGTGCTTTTGG - Intronic
1056581898 9:87894701-87894723 GAGACTGAGTGAGGTGCTACCGG - Intergenic
1061387001 9:130296274-130296296 GGCACTGTGCTAGGTGTTGCAGG + Intronic
1061564541 9:131429331-131429353 GCCACTTTCTAATGTGCTACAGG - Intronic
1061841094 9:133359042-133359064 GCCAGTGTGTTAGCTGCTCAGGG + Intronic
1062702534 9:137914869-137914891 GGCACTGTTCTAGGTGCTAGAGG + Intronic
1186552203 X:10517971-10517993 TGCACTGTGTTAGGTGCCAAAGG - Intronic
1189863003 X:45292438-45292460 GGCACTGTGCTAGGTGCTTTGGG + Intergenic
1190030748 X:46970511-46970533 GCCACAGTGTTTGGTGCACCTGG + Intronic
1190283048 X:48943930-48943952 GACACATTGTCAGGTGCTACAGG - Intronic
1190738376 X:53270698-53270720 GGCACTGTGTTAGGCACTAGGGG - Intronic
1192049845 X:67714711-67714733 GCCACTGTGTTAGGCTGTTCTGG - Intronic
1192182584 X:68925598-68925620 GCCATTGTGTTGGGTGCTGAGGG - Intergenic
1195922537 X:109998043-109998065 GCCACTCTGCTAGGTGCTGTGGG + Intergenic
1197255210 X:124255789-124255811 ACCACTGTGGTAGGTTCTGCAGG + Intronic
1198126939 X:133654193-133654215 GCTATTGTGTTAGGTGCCATGGG + Intronic
1198129709 X:133681563-133681585 GCCACTTTCTTTGCTGCTACTGG - Intronic
1199806930 X:151309373-151309395 GGCACTGTGCTTGGTGCTACAGG + Intergenic