ID: 903397418

View in Genome Browser
Species Human (GRCh38)
Location 1:23012515-23012537
Sequence GTGATGATATTCAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903397418 Original CRISPR GTGATGATATTCAGGGAGGG AGG (reversed) Intronic
902150968 1:14443074-14443096 GTTATGTAATTCAAGGAGGGTGG - Intergenic
902969291 1:20034951-20034973 GTGATGAGAATGAGGGAAGGGGG + Intronic
903397418 1:23012515-23012537 GTGATGATATTCAGGGAGGGAGG - Intronic
903541070 1:24096632-24096654 CTGATGAGAGGCAGGGAGGGTGG + Intronic
904361652 1:29977255-29977277 GGGATGATAGTGAGGGAGAGGGG - Intergenic
906033222 1:42736199-42736221 GTGTTGATATTCTGGGCTGGGGG - Intronic
906611735 1:47208631-47208653 GTGATGCTAATGAGGCAGGGAGG - Intergenic
907456314 1:54578390-54578412 GTGATGCTTTTCAGGGGGTGGGG - Intronic
907714712 1:56916168-56916190 GTAATGATCTGCAGGGAGGGAGG + Intronic
910341235 1:86190444-86190466 GAGATGATACTCATGGAGGGCGG - Intergenic
911363023 1:96902617-96902639 ATGTTGATTTTCAGGGACGGTGG + Intergenic
913184698 1:116359552-116359574 GTGATGGTCTTCAGGGTGGTGGG - Intergenic
916123583 1:161550121-161550143 GGGATGAGATTCAAGGTGGGAGG + Intronic
916133469 1:161631480-161631502 GGGATGAGATTCAAGGTGGGAGG + Intronic
916166774 1:161972250-161972272 GAGATGACAGTCAGGGAGAGAGG - Intergenic
916313452 1:163422271-163422293 GTGATGATATTAGGAGATGGGGG - Intergenic
919117847 1:193303468-193303490 GTGATGATATTTGGAGATGGTGG - Intergenic
924275978 1:242387460-242387482 GTGATGACATCCAGGGCGGAGGG + Intronic
1062797384 10:354709-354731 GTGAGGAAATTAGGGGAGGGAGG + Intronic
1070625553 10:78048559-78048581 ATGATGATATTCAGAGAGTCTGG + Intronic
1075385795 10:122054447-122054469 TTGATGATATCCAAGAAGGGCGG - Intronic
1076175525 10:128364926-128364948 GTGCTGCAATTCAGGGAGGTTGG + Intergenic
1079135932 11:17775967-17775989 GTGGTGCTATCCATGGAGGGGGG + Intronic
1079156396 11:17951963-17951985 GTGATGAGATTAGGGCAGGGAGG - Intronic
1080256451 11:30295735-30295757 GTGATGCAGTTCAGGGAAGGGGG - Intergenic
1080755156 11:35190184-35190206 GTGATGCCATTCAGGGAGGTGGG + Intronic
1081447890 11:43148000-43148022 CTCATAATATCCAGGGAGGGAGG - Intergenic
1084424072 11:69074984-69075006 GTGATGATGTGGAGGAAGGGCGG + Intronic
1085198648 11:74688056-74688078 GGGCTGATATTCAGGAAGGATGG - Intergenic
1088623457 11:111710506-111710528 TTGATGATTTTCAAGGATGGGGG - Intronic
1089312191 11:117565949-117565971 GAGATGACAGTGAGGGAGGGGGG - Intronic
1090838652 11:130471628-130471650 GAGATGGTATTCAGGAAGGTGGG + Intronic
1092955232 12:13543385-13543407 GTGAGGATTTTTAGGGAAGGAGG - Exonic
1093719167 12:22418524-22418546 GTGATGAAATTAAGAGATGGAGG + Intronic
1095225276 12:39671598-39671620 GTGATGATAGTCATGGTGGTGGG + Intronic
1095543608 12:43340321-43340343 GTAGTGATATTGAGGGAGGATGG - Intergenic
1097675723 12:62601117-62601139 TTCCTGATATGCAGGGAGGGGGG + Intergenic
1098472313 12:70859497-70859519 TTGAAGATTCTCAGGGAGGGGGG + Intronic
1098729415 12:74014415-74014437 ATGAGGATATTAAGTGAGGGAGG + Intergenic
1099249677 12:80237804-80237826 TTGAAGATATTCAGAGAGAGTGG + Intronic
1101598012 12:106184163-106184185 GAGGTGATATTCAAGGAGGGTGG + Intergenic
1102368162 12:112357478-112357500 GTGATGATAAGGAGGGTGGGAGG + Intronic
1103949801 12:124544519-124544541 CTGGGGATATTCAGGGTGGGAGG + Intronic
1104149633 12:126070316-126070338 GTGATGACATTCAGAGATGAAGG - Intergenic
1105073414 12:133252424-133252446 GTAATGTTATTCAGTGTGGGTGG + Intergenic
1106150836 13:27100215-27100237 GTTATTATTTTCAGGGACGGAGG - Intronic
1107050195 13:36038623-36038645 GTGATGCTATTCAGGTAGGTGGG + Intronic
1107967180 13:45607845-45607867 GTGATGCCATTCAGGGGTGGCGG - Intronic
1108880902 13:55114371-55114393 GTGAGGATATTACGGGAGGTAGG - Intergenic
1110647523 13:77905619-77905641 GTGATCATATTGAGTGAGGGTGG + Intronic
1110702257 13:78562530-78562552 ATGATGGTTTGCAGGGAGGGAGG + Intergenic
1111287389 13:86112680-86112702 GTGGAGATATTGAGGGAGAGAGG - Intergenic
1112341636 13:98557433-98557455 GTGATGATGGTGATGGAGGGAGG - Intronic
1113442381 13:110339313-110339335 GTGATGAGATTCCTGGATGGAGG + Intronic
1121841185 14:97135548-97135570 GTGATGAATGTCAGGGATGGAGG - Intergenic
1122094051 14:99358350-99358372 GTGATGACAATCACGGAAGGAGG - Intergenic
1122600391 14:102918429-102918451 GAGATGAGTTTCTGGGAGGGTGG - Intergenic
1122704838 14:103614200-103614222 GTGATGATACACAGGGTGGTTGG - Intronic
1129929418 15:79397912-79397934 ATGATGATAGTCAGAGAGGTTGG - Intronic
1132622370 16:873921-873943 GTCATGGTGCTCAGGGAGGGAGG + Intronic
1132998695 16:2838227-2838249 GGGCTGATATGCAAGGAGGGAGG + Intronic
1133527195 16:6617149-6617171 GTGCTTATAGTCAGGGATGGAGG - Intronic
1136268215 16:29133023-29133045 GTGATGAGATCCTGGGTGGGCGG + Intergenic
1137651144 16:50121640-50121662 ATGATTATAATCAGGGTGGGGGG - Intergenic
1137865028 16:51885395-51885417 TGGATGATATTTAGGGAAGGAGG + Intergenic
1138443651 16:57050009-57050031 GTGCTTGAATTCAGGGAGGGGGG - Intronic
1142064474 16:88053254-88053276 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064497 16:88053374-88053396 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064537 16:88053620-88053642 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064576 16:88053854-88053876 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064597 16:88053968-88053990 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142064637 16:88054214-88054236 GTGATGATAGTGAAGGAGGTGGG - Intronic
1142071526 16:88093361-88093383 GTGATGAGATCCTGGGTGGGCGG + Intronic
1143207948 17:5159117-5159139 GTGATTATTTTCAGGGACAGTGG + Intronic
1143875105 17:9985472-9985494 GTTGTGATATCCAGGGATGGGGG - Intronic
1144198709 17:12919874-12919896 GTGATCATATTTTGGGCGGGTGG + Intronic
1146352015 17:32102934-32102956 TTGGTGATGTTCAGGGAGTGGGG + Intergenic
1147318930 17:39634402-39634424 GTGAGGACATTCAGGGATGGAGG + Intronic
1149592694 17:57843537-57843559 GTGATGGTATTTAGAGATGGAGG + Intronic
1149872421 17:60194882-60194904 GTGATTATTTTCAGGGACAGTGG - Intronic
1150861542 17:68806008-68806030 GTGAAGATATTTGGGCAGGGAGG - Intergenic
1151034687 17:70784339-70784361 GTGATGTTATTTCGGGATGGTGG + Intergenic
1151035463 17:70793589-70793611 CTGATGATACTCAGGTAGGGAGG - Intergenic
1152145542 17:78566490-78566512 GAGCTGATGTCCAGGGAGGGAGG - Intronic
1152761933 17:82113203-82113225 GTCATGATAATCAGTGAAGGCGG + Intronic
1153134893 18:1905569-1905591 GTGCTGATTTTCAAGGATGGGGG - Intergenic
1153923924 18:9816135-9816157 GGGATGACACTCAGGGATGGAGG - Intronic
1155931330 18:31712006-31712028 GTGATTAAATGCAGGGTGGGAGG - Intergenic
1157204929 18:45689684-45689706 GTGATGGTAAGGAGGGAGGGTGG - Intergenic
1160430230 18:78805900-78805922 GTGGCCTTATTCAGGGAGGGTGG - Intergenic
1162562685 19:11426637-11426659 GAGATGACAAACAGGGAGGGCGG - Intronic
1164752107 19:30664685-30664707 GTGGTGAGAATCGGGGAGGGTGG + Intronic
1167621768 19:50564723-50564745 GGGATGAAATGCAGGGAGAGAGG + Intronic
1168467873 19:56618739-56618761 GTGATGAGAAACTGGGAGGGAGG + Intronic
925509872 2:4613379-4613401 GTAATCATAGTTAGGGAGGGAGG + Intergenic
926733278 2:16053571-16053593 GGGAAGAGATTCAGAGAGGGTGG + Intergenic
928198568 2:29232155-29232177 GTACCGATATCCAGGGAGGGAGG - Intronic
929262886 2:39885819-39885841 ATGATGATATTTAGGGATGCAGG - Intergenic
929458373 2:42083102-42083124 GTGATGAAGGTCAGGGAGGTGGG - Intergenic
929664102 2:43820505-43820527 GAGATGAGGTTCAGGGAAGGGGG - Intronic
934903063 2:98176322-98176344 GTGGTGATGATGAGGGAGGGAGG - Intronic
935835763 2:107051225-107051247 GAAATAATATACAGGGAGGGTGG - Intergenic
937052748 2:118905709-118905731 GTGATGATATTGAGGAACTGGGG + Intergenic
937279570 2:120708074-120708096 GTCTTGATTTTCAGGGAGTGTGG + Intergenic
939423450 2:142003644-142003666 GTAATGAAATGCAGGCAGGGTGG + Intronic
941064972 2:160891740-160891762 GTGGTGCTGTTCAGGGAGGAGGG - Intergenic
942038969 2:172039216-172039238 GTGATGATGTACAGAGAGGCAGG - Intronic
944916930 2:204370332-204370354 GTGTCTATATTAAGGGAGGGAGG + Intergenic
946570497 2:221018990-221019012 ATGATGGTGTGCAGGGAGGGAGG + Intergenic
947952034 2:234156404-234156426 ATGAGGATAGTCAGGGAGGCAGG + Intergenic
1169330660 20:4713699-4713721 GTGATGACACACAGGGAAGGAGG - Intergenic
1171498612 20:25575890-25575912 TAGATGATATGGAGGGAGGGAGG - Intronic
1173593963 20:44247207-44247229 GTAATGACATTCACGGAGCGGGG + Intronic
1178631666 21:34266410-34266432 GTTATGATGGGCAGGGAGGGAGG - Intergenic
1179825257 21:43961198-43961220 ATGCTGATATCCAGGGAGTGGGG + Intronic
1180571944 22:16732313-16732335 GAGATGAGAATCAGGGAGGAAGG + Intergenic
1180748032 22:18105116-18105138 GTCATGATGTTGAGGGAGGCTGG - Exonic
1182675802 22:32038826-32038848 ATGATGATGTGAAGGGAGGGAGG - Intergenic
1184356078 22:43980416-43980438 GTTAGGATGGTCAGGGAGGGTGG + Intronic
949332970 3:2942804-2942826 GTGATAATCTTCAGGAAGCGTGG + Intronic
949736465 3:7177647-7177669 GGAATGAAATGCAGGGAGGGAGG + Intronic
950624503 3:14234925-14234947 GTGATGAAACTGAGGGAGGGAGG + Intergenic
951098201 3:18656102-18656124 CTGATGATATTGGAGGAGGGTGG + Intergenic
951453297 3:22863777-22863799 GTGATTTTTTGCAGGGAGGGAGG + Intergenic
952713518 3:36454811-36454833 ATGATCAAATTCAGGGAGGGGGG + Intronic
953086598 3:39674392-39674414 GTGATTATATTAAAGTAGGGCGG - Intergenic
954376283 3:50195666-50195688 TTGATGAAATACTGGGAGGGAGG - Exonic
955984016 3:64554670-64554692 GTGATGAAATGCAAGGAGGCTGG - Intronic
956210337 3:66795738-66795760 GTGATGCAGTGCAGGGAGGGAGG - Intergenic
956393386 3:68799106-68799128 GTGAACATCTTGAGGGAGGGGGG - Intronic
956493493 3:69799298-69799320 ATGAAGAAATGCAGGGAGGGAGG + Intronic
956574033 3:70731413-70731435 GTAATAATAATCAGGAAGGGGGG + Intergenic
957106245 3:75892092-75892114 GAGATGAGAATCAGGGAGGAAGG - Intergenic
958156717 3:89764146-89764168 GTGAAGATATTGTGTGAGGGAGG - Intergenic
963058139 3:141204315-141204337 GTGGTGATAATGAAGGAGGGAGG + Intergenic
964593735 3:158397905-158397927 GTGAAGATTTTTAGAGAGGGTGG + Intronic
964700664 3:159562427-159562449 CTAATGTTCTTCAGGGAGGGAGG + Intronic
965057330 3:163738137-163738159 CTGCTGAGATTCAGGCAGGGAGG + Intergenic
966268322 3:178073509-178073531 GTGATTATATTCGTGGAGGATGG - Intergenic
969262199 4:6041097-6041119 GTGATGCAATTCAGGCAGGAAGG - Intronic
972858668 4:43139651-43139673 GTGATGTTCATCAGGGAGAGTGG + Intergenic
973152086 4:46900648-46900670 GTGATGATATTAAGAGGTGGGGG + Intronic
975820241 4:78263423-78263445 GTGAGCGTATGCAGGGAGGGAGG - Intronic
975837182 4:78435956-78435978 TTTATGATATTAAGGAAGGGCGG + Intronic
976816130 4:89149671-89149693 GTGAAGACACACAGGGAGGGTGG + Intergenic
977546481 4:98387840-98387862 GTGCTGATATTCACTGAGGGAGG + Intronic
978216491 4:106210726-106210748 GTGATAATATTTAAAGAGGGTGG + Intronic
979297560 4:119051068-119051090 GTAAAGATATTCAAGGAGGGTGG + Intronic
979378317 4:119976478-119976500 ATAAGGATATTCAGGGATGGTGG + Intergenic
980392837 4:132169224-132169246 GAGATGTCATTCAGGGAGGCTGG + Intergenic
982206015 4:152997719-152997741 GCTGTCATATTCAGGGAGGGTGG - Intergenic
983640820 4:169942575-169942597 GTGAGGATTTTCAGGGGAGGAGG - Intergenic
985248093 4:187996701-187996723 GAGATGAAATGCAGGGAGAGCGG - Intronic
986561928 5:9069007-9069029 GTGATGACGTACAGGGAAGGTGG + Intronic
988899040 5:35711621-35711643 GGGATGATAGCGAGGGAGGGAGG - Intronic
992045949 5:72889407-72889429 TGGAAGATATTAAGGGAGGGAGG + Intronic
992813664 5:80414701-80414723 GAGCTTAAATTCAGGGAGGGAGG + Intronic
993117176 5:83733309-83733331 GAGATGTTACTCAGGGAGGCTGG + Intergenic
995777093 5:115735251-115735273 GTGATGAAATTGAGTGAGGCAGG - Intergenic
998598825 5:143563095-143563117 GTAATGATATTCGACGAGGGTGG - Intergenic
999580402 5:153032022-153032044 GTGATGGTATTTAGAGATGGGGG + Intergenic
1000496587 5:161991697-161991719 GTGATCAAATAAAGGGAGGGAGG - Intergenic
1001518856 5:172376646-172376668 GTGATGTTATCCCTGGAGGGAGG - Intronic
1001746592 5:174097109-174097131 GTGATTAGATGGAGGGAGGGTGG + Intronic
1002574195 5:180162205-180162227 GTCGTGATTTTCAGCGAGGGAGG - Intronic
1003030515 6:2596858-2596880 CTGATGACATTCAGGGCTGGTGG + Intergenic
1003048600 6:2760361-2760383 ATGATGATGTGCTGGGAGGGTGG - Intergenic
1003217535 6:4128361-4128383 GTAATGGTATTCAAGGAAGGTGG + Intronic
1003460316 6:6322521-6322543 GTGATGGTATTCATTGAGGTAGG - Intergenic
1003586164 6:7390883-7390905 TAGATGATGTTCATGGAGGGTGG + Intronic
1006173693 6:32109478-32109500 GTGATGCTAGACAGGGAGTGGGG - Intronic
1006228513 6:32561663-32561685 TTGATCATAATCAGGGAGCGTGG - Intronic
1006456449 6:34134676-34134698 ATGAAGAAAGTCAGGGAGGGAGG - Intronic
1008822968 6:55656176-55656198 ATGATGTTATTCAGTGAGGTAGG - Intergenic
1010700255 6:79036283-79036305 GTAATGATATTTAAGGAGGTGGG - Intronic
1012979635 6:105816073-105816095 GTCATCATTTTCAGGGAGTGAGG + Intergenic
1015570833 6:134619708-134619730 GTGAGGAGATGCAGGGAGGATGG + Intergenic
1015881349 6:137873165-137873187 GAAAAGATATTTAGGGAGGGAGG + Intronic
1016468713 6:144352433-144352455 GTGATGGTATTTAAAGAGGGAGG + Intronic
1022469231 7:30671945-30671967 GTGATGACATTGAGGTGGGGAGG + Intronic
1022680629 7:32542144-32542166 GTGGTGATATCAAGGGTGGGAGG + Intronic
1027649634 7:80850588-80850610 GTGGTTATATTCAGGGAGAAGGG + Intronic
1029101650 7:98135973-98135995 GTCATGATAAGCAGGGAGGGAGG - Intronic
1029361579 7:100092001-100092023 CTGATGCTCTTCAGTGAGGGAGG + Exonic
1029985229 7:104916852-104916874 TTGATGTTATTTAGGTAGGGAGG + Intergenic
1030516020 7:110538779-110538801 GTGATGTTATTCATTGAGGAAGG - Intergenic
1030692546 7:112551111-112551133 GTGAGGAGAATCAGGCAGGGAGG - Intergenic
1031333238 7:120493046-120493068 GTGATGGTATTCAGAGGTGGAGG - Intronic
1032685288 7:134226828-134226850 GTGATGGTAGGCAGGGAGTGAGG + Intronic
1035124907 7:156601539-156601561 GTGGGCATATTCATGGAGGGGGG - Intergenic
1035359604 7:158302140-158302162 ATGATGACATTCAGGGTGGTGGG + Intronic
1035772733 8:2161771-2161793 GTGAGGATACTGAGAGAGGGCGG - Intronic
1036164510 8:6420038-6420060 GTGATGCTGGTGAGGGAGGGAGG + Intronic
1036942064 8:13061086-13061108 GTGATGAGATTTAGGTGGGGAGG + Intergenic
1037270652 8:17126115-17126137 GGGATGAGTTTCAGGCAGGGAGG + Intergenic
1038697379 8:29818462-29818484 GTGGTGAGATGCAGGGAGGTGGG + Intergenic
1039793283 8:40892090-40892112 GTGAGGGCGTTCAGGGAGGGTGG - Intronic
1044674883 8:94719269-94719291 TTCATGATATTCTGGGGGGGGGG - Intergenic
1045099541 8:98830267-98830289 GGGATGAAATTCAGGTAGGATGG + Intronic
1045826141 8:106401127-106401149 GTGATGACATTCAAGGACTGTGG - Intronic
1046163408 8:110396685-110396707 GTGATGATATTCTGTAAGGATGG + Intergenic
1047257466 8:123226243-123226265 TTGATGATGTTCAGGCAGGCAGG + Exonic
1047814577 8:128448850-128448872 ATGATGATATTGAGGAGGGGAGG + Intergenic
1052420881 9:28241794-28241816 GAGATGTTATTCAGGGAGGCTGG - Intronic
1054720282 9:68596535-68596557 GGGATGAAATTAAGGTAGGGGGG - Intergenic
1054828203 9:69594502-69594524 GTGAAGAGAATCAGGGAGTGAGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058136892 9:101317268-101317290 GTGATGATATTCAAGGGGAAAGG + Intronic
1058190781 9:101912288-101912310 GGGATAACAGTCAGGGAGGGTGG + Intergenic
1058257354 9:102784091-102784113 GTGATGTTATGGAGGGTGGGAGG + Intergenic
1059431693 9:114254361-114254383 GTGATGATGTGCAGGGGGTGGGG + Intronic
1060900245 9:127250680-127250702 GTCGAGATTTTCAGGGAGGGAGG + Intronic
1061445523 9:130635154-130635176 GTGGTGAGATTCAGGGAAGGAGG + Intronic
1203454578 Un_GL000219v1:153502-153524 GTGATGATAATAAGGGAATGTGG - Intergenic
1185629745 X:1507451-1507473 GTGATGATTTTCAGCTAGGAAGG - Intronic
1187068972 X:15869078-15869100 GTGATGATATTTGGAGATGGGGG - Intergenic
1189685397 X:43558878-43558900 GTGATTACCTTTAGGGAGGGAGG + Intergenic
1192630552 X:72774620-72774642 TTGATGATATTCACTGAAGGAGG - Intergenic
1192651158 X:72946184-72946206 TTGATGATATTCACTGAAGGAGG + Intergenic
1193719418 X:84970986-84971008 GAGATGTTATTCAAGGAGGCTGG + Intergenic
1193909953 X:87292096-87292118 ATGGAGATATTCAGGGAAGGAGG - Intergenic
1198626795 X:138584617-138584639 GTGATGCTGTTCAGGGAGAAGGG - Intergenic
1199599531 X:149533688-149533710 GTGAGGAGATCCAGGCAGGGCGG + Exonic
1199651100 X:149946519-149946541 GTGAGGAGATCCAGGCAGGGCGG - Intergenic
1201915948 Y:19181295-19181317 GTGATGTTATTGTGGGGGGGGGG + Intergenic